Hedysarum alpinum
speciesAt a glance
Occurrence records4 234
Data sources15
Biological traits100
DNA specimens66
eDNA detections30
Sources15 archives
Databases and archives Hedysarum alpinum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 234 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics66 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources100 traits
Chemical compositionFooDB · LOTUS · NPASS5 593 compounds
Occurrence & distributionGBIF4 234 records
Environmental DNA1 datasets · 3 countries30 detections
DNA & barcodingBOLD · NCBI66 specimens
Genome at a glanceCCDB2n = 14
01Narrative
Hedysarum alpinum est une espèce de plantes à fleurs de la famille des Fabaceae. C'est une plante herbacée trouvée dans l'hémisphère nord.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTWCVPUSDA
Size & morphology6
Plant height0.61 m
⚠ sources differ — GIFT: 0.61 m · USDA: 0.61 m · TRY: 0.455 m
Plant height max1.2 m
Plant height min0.4 m
Seed mass5.79 mg
Seed mass max6.8 mg
Seed mass min4.59 mg
Life cycle & reproduction24
After harvest regrowth rateRapid
Bloom periodEarly Summer
Coppice potentialNo
DeciduousnessOther
Flower colourpurple
Flower conspicuousYes
Flowering endJul
Flowering startJun
Growth rate USDARapid
Life formperennial
Life spanperennial
Lifespan categoryShort
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodYes
Propagated by sprigsNo
Propagated by tubersNo
Resprout abilityNo
Seed spread rateModerate
Vegetative spread rateModerate
Diet & foraging1
Parasiteindependent
Habitat & environment25
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatLow
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterDense
Foliage textureFine
Fruit colourbrown
Growth formherb
Growth form USDARhizomatous
Habitat GIFTforest, meadows, mountains, shores
Hedge toleranceHigh
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Root depth min12 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry23
Anaerobic toleranceLow
C:N ratioMedium
Caco3 toleranceLow
Cold stratification requiredYes
Drought toleranceLow
Fertility requirementLow
Fire resistantNo
Fire toleranceMedium
Frost free days min120 days
Leaf n37.09 mg/g
Leaf p1.4 mg/g
Moisture useMedium
Nitrogen fixation levelLow
Photosynthetic pathwayC3
Precipitation max80 in
Precipitation min28 in
Protein potentialHigh
Salinity toleranceNone
Shade toleranceHigh
Soil pH max8 pH
Soil pH min6 pH
Specific leaf area (SLA)15.62 mm²/mg
Temperature min-62 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalHigh
Palatable graze animalHigh
Palatable humanYes
Post productNo
Pulpwood productNo
Seeds per pound70 000 per lb
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousYes
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max20 000 per acre
Planting density min5 120 per acre
03Chemical composition5 593 compounds
Compounds documented for Hedysarum alpinum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingVegetables
Compound class profile5 classes
Aminoacids67
Glycerophospholipids57
Cinnamic acids and derivatives30
Purine nucleos(t)ides26
Monosaccharides25
Documented compounds5 593 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Phosphorus | 67 mg/100g | FooDB | |
| Retinol | 16 IU | FooDB | |
| L-Ascorbic acid | 11 mg/100g | FooDB | |
| Nicotinic acid | 1.3 mg/100g | FooDB | |
| Thiamine | 0.1 mg/100g | FooDB | |
| Riboflavine | 0.07 mg/100g | FooDB |
05DNA & barcoding66 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hedysarum alpinum has left across the world's sequence archives.
At a glance
DNA specimens66
Marker genes5
GenBank sequences10
eDNA detections30
Countries3
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGTCTGCCTGGGCGTCACATATC …
Hedysarum alpinum var. americanum voucher CCDB-18330-B4 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL★rbcLa★ITS9★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Hedysarum alpinum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidydiploid inferred
Chromosome records14–162n range14median14mode17records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1414×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-fedorov +2
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 265–268.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1990. Chromosome numbers in some species of flowering plants of the Urals (the Komi Autonomous Soviet Socialist Republic). Bot. Žhurn. (Moscow & Leningrad) 75: 1622–1624.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.
CCDB · book-ipcn75-78 — Krogulevich 1978
CCDB · book-fedorov — Anderson M. M. 1940
CCDB · book-fedorov — Ledingham 1957)
CCDB · book-fedorov — Ledingham 1957
CCDB · book-fedorov — Holmen 1962
CCDB · book-fedorov — Sakai K. 1934
CCDB · book-atlas-flowering-plants — Sakai 1934
CCDB · Cave1957 — Ledingham
2n 163×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zhang, J. f. Yan, X. q. Fu & L. y. Wang. 1989. Chromosome numbers and geographical distribution of 68 species of forage plants. Grassl. China 4: 53–60.
CCDB · book-ipcn73-74 — PACKER, J. G., & G.D. MCPHERSON. 1974. Chromosome numbers in some vascular plants from northern Alaska. Canad. J. Bot. 52: 1095-1099.
CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.
n 71×CCDB · Cave1962
CCDB · Cave1962 — Holmen 1962
n 81×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — MULLIGAN, G.A., & W.J. CODY. 197 3. In IOPB chromosome number reports! XL. Taxon 22: 258-291.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type4 234 records
Wild obs. + sensor3 240
Museum / vouchered973
Cultivated / captive6
Other15
Origin
Introduced6
Range
Area of Occupancy AOO10 148 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy83% within 1 km
≤100 m 1 777≤1 km 302≤10 km 156>10 km 259
2 494 georeferenced · 746 without coordinates
Open the mapobservation + sensor3 240
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy33% within 1 km
≤100 m 21≤1 km 87≤10 km 202>10 km 21
331 georeferenced · 642 without coordinates
Open the institutions mapphysical evidence973
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 6
6 georeferenced
Open the mapnot free-living6
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions54 of 96 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 100 |
| University of Alberta Museumslocation not on record | 73 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 57 |
| Anchorage, US | 52 |
| IB FRC Komi SC UB RASlocation not on record | 42 |
| Vancouver, CA | 38 |
| Yukon Universitylocation not on record | 26 |
| Beijing, CN | 24 |
| Victoria, CA | 23 |
| Québec, CA | 22 |
| Spearfish, US | 18 |
| Saint John, CA | 16 |
| Northeastern Forestry Universitylocation not on record | 16 |
| Université Lavallocation not on record | 15 |
| Montréal, CA | 15 |
| LDlocation not on record | 15 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 15 |
| Central Sibirian Botanical Gardenlocation not on record | 14 |
| Whitehorse, CA | 14 |
| University of Stellenboschlocation not on record | 13 |
| Acadia Universitylocation not on record | 13 |
| WTUlocation not on record | 13 |
| Guangzhou, CN | 12 |
| Urumqi, CN | 11 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 10 |
| Toronto, CA | 9 |
| Chongqing Museumlocation not on record | 8 |
| University of Lethbridgelocation not on record | 8 |
| Saint Louis, US | 7 |
| Urumqi, CN | 7 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 7 |
| Missoula, US | 7 |
| Jiangxi College of Educationlocation not on record | 6 |
| Pechora-Ilych Nature Reservelocation not on record | 6 |
| USFS/BHSClocation not on record | 5 |
| Research Collection of B. A. Bennettlocation not on record | 5 |
| Kyoto Universitylocation not on record | 5 |
| Moscow, US | 4 |
| Paris, FR | 4 |
| IB FRC Komi SC UB RAS | Pechora-Ilych Nature Reservelocation not on record | 4 |
| IWEP FEB RASlocation not on record | 4 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 3 |
| Provo, US | 3 |
| Oskarshamn, SE | 3 |
| Kandalaksha State Nature Reservelocation not on record | 3 |
| Pocatello, US | 3 |
| Bergen, NO | 3 |
| Bozeman, US | 3 |
| Bronx, US | 3 |
| BRNUlocation not on record | 3 |
| Boise, US | 3 |
| Edinburgh, GB | 2 |
| Ann Arbor, US | 2 |
| Chadron, US | 2 |
| ASUlocation not on record | 2 |
| Philadelphia, US | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Bloomington, US | 2 |
| Yangling, CN | 2 |
| Flagstaff, US | 2 |
| ENTClocation not on record | 2 |
| 东北师范大学自然博物馆location not on record | 2 |
| Chapel Hill, US | 2 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 2 |
| Durham, US | 2 |
| Inner Mongolia Universitylocation not on record | 2 |
| MAlocation not on record | 1 |
| Davis, US | 1 |
| Orem, US | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| San Luis Obispo, US | 1 |
| Kew, GB | 1 |
| Denver, US | 1 |
| Claremont, US | 1 |
| Chinese Academy of Forestrylocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| GB | 1 |
| Columbia, US | 1 |
| WINlocation not on record | 1 |
| Albuquerque, US | 1 |
| Emporia, US | 1 |
| University of South Dakotalocation not on record | 1 |
| Riyadh Municipalitylocation not on record | 1 |
| New Haven, US | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Kunming, CN | 1 |
| Logan, US | 1 |
| Tsukuba, JP | 1 |
| Madison, US | 1 |
| Philadelphia, US | 1 |
| Llocation not on record | 1 |
| Phoenix, US | 1 |
| Bangkok, TH | 1 |
| Uppsala, SE | 1 |
| St. Paul, US | 1 |
| Pullman, US | 1 |
96 institutions · 853 of 973 vouchered records shown · 118 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA30 detections
Where the DNA of Hedysarum alpinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found30
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 30 detections have coordinates
Open the map3 countries0
Gravels inland and above high water in silty…Coastal slope failure. Slope 44 % aspect 30 …Outer delta on peat and eroded driftwood wit…Floodplain meadowRiparian old growth Picea glauca.Forest (Larix sibirica - Betula)
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.1 °C 5.60–19.3
Seasonal swing summer↔winter41.4 °C
Max temp (day)19.0 °C 8.80–24.0
Min temp (night)8.40 °C 3.60–13.0
Precipitation82.8 mm/mo 43.5–140
Air humidity57.6 % 53.1–65.2
Moisture balance-15.1 mm/mo
Vapour deficit681 Pa 319–947
Wind speed2.70 m/s
Cloud cover41.9 % 38.3–72.2
CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.