Hedychrum rutilans

Dahlbom, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Chrysididae/Hedychrum

At a glance

Occurrence records7 408

Data sources7

Biological traits0

DNA specimens34

eDNA detections38

Sources7 archives

Databases and archives Hedychrum rutilans's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 408 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 408 records

Environmental DNA1 datasets · 7 countries38 detections

DNA & barcodingBOLD34 specimens

01Narrative

Hedychrum rutilans is a species of cuckoo wasps (insects in the family Chrysididae). The species occurs primarily in Austria, Italy, Bulgaria, Greece, France, Poland, Portugal, Spain, Switzerland and in North Africa.Fauna EuropaeaAgnoli, G. L.; Rosa, P. (2011). Hedychrum rutilans Dahlbom, 1854 - Database of the Italian Chrysididae on Chrysis.net The head and thorax are metallic green with red spots, while the abdomen is red. The color is more green and partially golden in the male and more extensively golden-red in the female. The body is somewhat hairy. H. rutilans – female feeding on Mentha sp.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hedychrum rutilans has left across the world's sequence archives.

At a glance

DNA specimens34

BINs2

Marker genes1

eDNA detections38

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 42 variable positions, in barcode order

4Amostly conserved

7Amostly conserved

52Amostly conserved

79Gvariable

121Amostly conserved

154Tmostly conserved

163Tmostly conserved

175Gmostly conserved

220Tmostly conserved

226Cmostly conserved

229Gmostly conserved

232Cmostly conserved

253Amostly conserved

316Gmostly conserved

322Gmostly conserved

328Gmostly conserved

334Tmostly conserved

340Cmostly conserved

343Tmostly conserved

352Tmostly conserved

364Tmostly conserved

367Tmostly conserved

373Amostly conserved

376Gmostly conserved

379Amostly conserved

403Amostly conserved

417Tmostly conserved

418Cvariable

475Avariable

479Tmostly conserved

496Gmostly conserved

502Gmostly conserved

511Gmostly conserved

529Tmostly conserved

548Tmostly conserved

550Amostly conserved

577Gmostly conserved

581Tmostly conserved

592Tmostly conserved

631Avariable

634Tmostly conserved

637Amostly conserved

TATATTATATTTTTTGTTTGGGATGTGATCAGGAATTTTAGGAGCATCTTTAAGAATAATTATTCGTTTAGAGTTGGGGAGTTCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes17

BINs2

Most divergent pair11.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hedychrum longicollesame genus9.4%Hedychrum confusumsame genus10.6%Hedychrum gerstaeckerisame genus10.9%Hedychrum nobilesame genus11.6%Hedychrum chalybaeumsame genus14.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type7 408 records

Wild obs. + sensor6 540

Museum / vouchered868

Range

Area of Occupancy AOO7 968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤100 m 714≤1 km 481≤10 km 4 663>10 km 45

5 903 georeferenced · 637 without coordinates

Open the mapobservation + sensor6 540

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 52≤1 km 71≤10 km 417>10 km 5

545 georeferenced · 323 without coordinates

Open the institutions mapphysical evidence868

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	271
NMOKlocation not on record	119
Philadelphia, US	95
Uniwersytet Łódzkilocation not on record	86
Helsinki, FI	77
	58
I.I. Schmalhausen Institute of Zoologylocation not on record	42
Natural History Museum Rotterdamlocation not on record	27
ZSMlocation not on record	14
Muzeum Górnośląskie w Bytomiulocation not on record	11
Tallinn, EE	8
Kharkiv Entomological Societylocation not on record	6
Tilburg, NL	4
Provincia di Livornolocation not on record	3
Bonn, DE	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Metsähallituslocation not on record	1
Nature Museum of Kharkiv National Universitylocation not on record	1
Tartu, EE	1

19 institutions · 827 of 868 vouchered records shown · 41 without an institution code

09Environmental DNA38 detections

Where the DNA of Hedychrum rutilans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 16.9–20.6

Seasonal swing summer↔winter18.4 °C

Max temp (day)22.6 °C 21.1–24.4

Min temp (night)14.2 °C 12.7–18.0

Precipitation59.7 mm/mo 36.1–116

Air humidity57.7 % 56.5–60.4

Moisture balance-71.8 mm/mo -108–-18.6

Vapour deficit953 Pa 793–990

Wind speed2.50 m/s 1.50–3.90

Cloud cover35.2 % 32.8–43.5

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hedychrum rutilans

At a glance

Sources7 archives

At a glance

Record type7 408 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 408 records