Hebeloma avellaneum

Kauffman · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hymenogastraceae/Hebeloma

At a glance

Occurrence records10

Data sources7

Biological traits0

DNA specimens3

eDNA detections4

Sources7 archives

Databases and archives Hebeloma avellaneum's data was compiled from.

GBIFGlobal Biodiversity Information Facility10 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF10 records

Environmental DNA2 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hebeloma avellaneum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences6

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOP223489.1 ↗614 bpUSA · 2021

ACGT

AAGGATCATTATTGAATGAACTTGGTGTGGTTGTCGCTGGCCCTCTCGGGGGCATGTGCACACCTACCATCCTCATCTCTCCACCTGTGC …

Hebeloma avellaneum bio-material iNAT:90716181 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6★ITS1

fungal barcode

08Occurrence & distribution

Record type10 records

Wild obs. + sensor2

Museum / vouchered8

Range

Area of Occupancy AOO32 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	2
Ann Arbor, US	2
TENN-Flocation not on record	1
Personal Herbarium of Gabriela D'elialocation not on record	1
WU-MYClocation not on record	1

5 institutions · 7 of 8 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Hebeloma avellaneum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys2

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 12.0–12.0

Seasonal swing summer↔winter24.5 °C

Max temp (day)18.7 °C

Min temp (night)5.50 °C

Precipitation79.5 mm/mo

Air humidity45.2 %

Moisture balance-64.7 mm/mo

Vapour deficit768 Pa

Wind speed3.40 m/s

Cloud cover21.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)