Haworthia marumiana

Uitewaal · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Haworthia

At a glance

Occurrence records17

Data sources9

Biological traits15

DNA specimens28

eDNA detections8

Sources9 archives

Databases and archives Haworthia marumiana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF17 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI28 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Haworthia marumiana ist eine Pflanzenart der Gattung Haworthia in der Unterfamilie der Affodillgewächse (Asphodeloideae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.5 m

Plant height min0.01 m

Life cycle & reproduction3

Life formsucculent perennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 500 m

Elevation min500 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Haworthia marumiana has left across the world's sequence archives.

At a glance

DNA specimens28

Marker genes5

GenBank sequences10

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJQ025248.1 ↗352 bp

ACGT

CCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCCGAAAGGACGACCGCGAACCATCGATCTATCTGCAACGAGCGACCGAGCATCG …

Haworthia marumiana var. archeri voucher BHD235 internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL8★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Haworthia marumiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×CCDB · kew

CCDB · kew — Zonneveld BJM. 2015. Nuclear genome sizes of 343 accessions of wild collected Haworthia and Astroloba (Asphodelaceae, Alooideae), compared with the genome sizes of Chortolirion, Gasteria and 83 Aloe species. Plant Systematics and Evolution 301: 931-953.

n 141×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BRANDHAM, P.E. 1971. Chromosomes of the Liliaceae II, Polyploidy and karyotype variation in the Aloineae. Kew Bull. 25: 381-399.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type17 records

Wild obs. + sensor3

Museum / vouchered14

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Research Collection of Bruce Bayerlocation not on record	7

1 institutions · 7 of 14 vouchered records shown · 7 without an institution code

09Environmental DNA8 detections

Where the DNA of Haworthia marumiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 18.1–28.2

Seasonal swing summer↔winter14.1 °C

Max temp (day)30.4 °C 25.3–35.0

Min temp (night)14.8 °C 11.5–20.7

Precipitation24.0 mm/mo 10.4–26.6

Air humidity50.6 % 43.6–53.5

Moisture balance-139 mm/mo -168–-109

Vapour deficit1,280 Pa 984–2,163

Wind speed3.30 m/s 3.10–4.00

Cloud cover14.9 % 13.2–27.1

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)