Haloxylon salicornicum

(Moq.) Bunge ex Boiss. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Haloxylon

At a glance

Occurrence records1 851

Data sources12

Biological traits20

DNA specimens12

eDNA detections6

Sources12 archives

Databases and archives Haloxylon salicornicum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 851 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Chemical compositionLOTUS · NPASS101 compounds

Occurrence & distributionGBIF1 851 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI12 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Haloxylon salicornicum is a shrub or undershrub belonging to the family Amaranthaceae. It is a desert shrub and is found in Israel, Jordan, Egypt, Saudi Arabia, Kuwait, Oman, United Arab Emirates, Afghanistan and Pakistan.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height0.2 m

Plant height max0.6 m

Plant height min0.26 m

Seed mass1.18 mg

Life cycle & reproduction7

Deciduousnessevergreen

Dispersal typewind

Flowering endOct

Flowering startSep

Life formsubshrub or shrub

Life spanperennial

Lifespan years1 years

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max800 m

Elevation min400 m

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC4

03Chemical composition101 compounds

Compounds documented for Haloxylon salicornicum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Stigmastane steroids11

Ursane and Taraxastane triterpenoids9

Oleanane triterpenoids8

Unsaturated fatty acids6

Labdane diterpenoids6

Documented compounds101 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-gamma-Tocopherol	present	NPASS
(+)-Ursolic Acid	present	LOTUS
(1S,4AS,7S,7aS)-7-hydroxy-7-methyl-1-(((2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(((4-hydroxybenzoyl)oxy)methyl)tetrahydro-2H-pyran-2-yl)oxy)-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylic acid	present	NPASS
(22E,24S)-5alpha,8alpha-epidioxy-24-methylcholesta-6,22-dien-3beta-ol	present	LOTUS
(22E,24S)-5alpha,8alpha-epidioxy-24-methylcholesta-6,9,22-trien-3beta-ol	present	LOTUS
(24S)-24-hydroxyoctacosan-4-one	present	LOTUS
(2E)-2-[(4aS,5R,7R,8R,8aS)-5-acetyloxy-4,4,7,8a-tetramethylspiro[2,3,4a,5,6,7-hexahydro-1H-naphthalene-8,5'-oxolane]-2'-ylidene]acetic acid	present	NPASS
(2R,3R,4R,5R,6S)-2-[[(3S,8S,9S,10R,13R,14S,17R)-17-[(E,2R,5S)-5-ethyl-6-methylhept-3-en-2-yl]-10,13-dimethyl-2,3,6,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-6-methyloxane-3,4,5-triol	present	LOTUS
(2R,3R,4S,5S,6R)-2-[[(3S,8S,9S,10R,13R,14S,17R)-17-[(E,2R,5S)-5-ethyl-6-methylhept-3-en-2-yl]-10,13-dimethyl-2,3,6,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2S,3S,4R)-4-[(3S)-3-hydroxy-3-methylpent-4-enyl]-3,4,8,8-tetramethyl-2,3,6,7-tetrahydronaphthalen-2-ol	present	NPASS

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Haloxylon salicornicum has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes4

GenBank sequences10

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOM039389.1 ↗331 bpUnited Arab Emirates · 2018

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Haloxylon salicornicum voucher MPSH5 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Haloxylon salicornicum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 189×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3

CCDB · iber-fl — Nuevos datos cariolgicos de Chenopodiaceae ibricas. Lago Canzobre, E. & S. Castroviejo.Nova Acta Ci. Compost. (Biol.)3: 201-203(1992).

CCDB · ipcn-api-dl — Castroviejo, S. & E. Lago. 1992. Nuevos datos cariológicos de Chenopodiaceae Ibéricas. Nova Acta Ci. Compostelana, Biol. 3: 201–203.

CCDB · book-ipcn67-71 — MURIN, A., & I.I. CHAUDHRI. 1970. In IOPB chromosome number reports XXVI. Taxon 19: 264-269. 70-322 NAG, K.K., & B.M. JOHRI. 1969. Organogenesis and chromosomal constitution in embryo callus of Nuytsia floribunda. Phytomorphology 19: 405-408.

CCDB · book-ipcn67-71 — BHATTACHARYA, S.S., M.M. KHALIFA, & I.I. CHAUDHRI. 1971. In IOPB chromosme number reports XXXII. Taxon 20: 349-356.

CCDB · book-indian_vol1 — Murin, A. & Chaudhri, I.I. 1970

CCDB · book-indian_vol1 — Pope, C.L. & McArthur,_ B.D. 1977

CCDB · CromoCat 2015 — Murín, A. & A. Chaudhri. (1970). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXVI]. Taxon 19(2): 266-268.

CCDB · iapt — IAPT/IOPB Chromosome Data 25

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 851 records

Wild obs. + sensor1 763

Museum / vouchered88

Range

Area of Occupancy AOO2 812 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy34% within 1 km

≤100 m 60≤1 km 5≤10 km 119>10 km 7

191 georeferenced · 1 572 without coordinates

Open the mapobservation + sensor1 763

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence88

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	17
MeiseBGlocation not on record	12
Wlocation not on record	10
Edinburgh, GB	9
Rishon Le Zion, IL	5
Moscow State Universitylocation not on record	3
GZUlocation not on record	3
Sharjah Research Academy, Seed Bank and Herbariumlocation not on record	2
Paris, FR	2
Dresden, DE	2
Sharjah Seed Bank & Herbariumlocation not on record	2
MAlocation not on record	1
University of Agriculture, Faisalabadlocation not on record	1
Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record	1
Berlin, DE	1
Natural History Museum Rotterdamlocation not on record	1
University of Stellenboschlocation not on record	1

17 institutions · 73 of 88 vouchered records shown · 15 without an institution code

09Environmental DNA6 detections

Where the DNA of Haloxylon salicornicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median30.8 °C 28.4–32.2

Seasonal swing summer↔winter18.9 °C

Max temp (day)38.4 °C 33.4–40.6

Min temp (night)23.8 °C 21.6–24.6

Precipitation6.70 mm/mo 3.80–30.7

Air humidity41.5 % 41.3–51.6

Moisture balance-182 mm/mo -184–-130

Vapour deficit2,607 Pa 1,894–2,802

Wind speed2.40 m/s 2.20–2.90

Cloud cover14.7 % 13.8–26.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Haloxylon salicornicum

At a glance

Sources12 archives

Size & morphology4

Life cycle & reproduction7

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

Compound class profile5 classes

Documented compounds101 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 851 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 851 records