Halgerda batangas

Carlson & Hoff, 2000 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Discodorididae/Halgerda

At a glance

Occurrence records769

Data sources8

Biological traits4

DNA specimens17

eDNA detections1

Sources8 archives

Databases and archives Halgerda batangas's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility707 records↗

OBISOcean Biodiversity Information System62 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS769 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD17 specimens

01Narrative

Halgerda batangas is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusk in the family Discodorididae.WoRMS (2014). Halgerda batangas Carlson & Hoff, 2000. Accessed through: World Register of Marine Species on 2015-01-09.Dayrat B. 2010. A monographic revision of discodorid sea slugs (Gastropoda, Opisthobranchia, Nudibranchia, Doridina). Proceedings of the California Academy of Sciences, Series 4, vol. 61, suppl. I, 1-403, 382 figs.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max12 m

Depth min7 m

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Halgerda batangas has left across the world's sequence archives.

At a glance

DNA specimens17

BINs2

Marker genes1

eDNA detections1

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 65 variable positions, in barcode order

6Tmostly conserved

25Amostly conserved

29Tmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

34Amostly conserved

37Cmostly conserved

38Cmostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

44Amostly conserved

45Cmostly conserved

46Amostly conserved

47Gmostly conserved

48Gmostly conserved

49Gmostly conserved

50Cmostly conserved

51Tmostly conserved

52Tmostly conserved

53Amostly conserved

54Gmostly conserved

55Cmostly conserved

56Tmostly conserved

59Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Amostly conserved

68Tmostly conserved

69Tmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

80Amostly conserved

82Amostly conserved

84Cmostly conserved

85Gmostly conserved

87Gmostly conserved

89Gmostly conserved

90Cmostly conserved

92Tmostly conserved

95Cmostly conserved

96Tmostly conserved

99Gmostly conserved

161Gmostly conserved

172Gvariable

263Tmostly conserved

292Amostly conserved

328Amostly conserved

386Cmostly conserved

400Cmostly conserved

403Amostly conserved

496Gmostly conserved

523Gmostly conserved

625Amostly conserved

637Cmostly conserved

AACACTATATATTATTTTTGGAATATGGTGTGGACTCCTAGGAACAGGGCTTAGCTTATTAATTCGATTTGAATTAGGAACAGCGGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes5

BIN1

Most divergent pair0.91%

OtherAsiaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Halgerda diaphanasame genus1.6%Halgerda carlsonisame genus1.8%Halgerda aurantiomaculatasame genus4.0%Halgerda willeyisame genus11.1%Halgerda wasinensissame genus11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type769 records

Wild obs. + sensor689

Museum / vouchered80

Range

Area of Occupancy AOO1 108 km²

Depth

0–200 m sunlit41

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 14 m · max 100 m · 41 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 223≤1 km 244≤10 km 113>10 km 53

633 georeferenced · 56 without coordinates

Open the mapobservation + sensor689

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 1≤1 km 14≤10 km 2>10 km 8

25 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence80

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	21
ZFMK/UNSRATlocation not on record	21
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Museum and Art Gallery of the Northern Territorylocation not on record	2
Sydney, AU	2
Los Angeles, US	1

6 institutions · 50 of 80 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Halgerda batangas was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)