Hakea drupacea

(C.F.Gaertn.) Roem. & Schult. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Hakea

At a glance

Occurrence records763

Data sources9

Biological traits53

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Hakea drupacea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility763 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources53 traits

Occurrence & distributionGBIF763 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Hakea drupacea, commonly known as sweet scented hakea, is a tree or shrub which is native to south west Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology21

Fruit length28.8 mm

⚠ sources differ — AusTraits: 28.8 mm · GIFT: 23 mm

Fruit width22.2 mm

⚠ sources differ — AusTraits: 22.2 mm · GIFT: 18 mm

Leaf length80 mm

Leaf length max75 mm

Leaf mass per area415 g/m2

Leaf size312 mm²

Leaf width1.3 mm

⚠ sources differ — AusTraits: 1.3 mm · GIFT: 2 mm

Leaf width max2 mm

Leaf width min2 mm

Plant height2.5 m

⚠ sources differ — AusTraits: 2.5 m · TRY: 4 m

Plant height max4 m

Plant height min1 m

Seed length18 mm

Seed length max18.5 mm

Seed length min18.5 mm

Seed mass16.87 mg

Seed mass max17.1 mg

Seed mass min17.1 mg

Seed width6 mm

Seed width max6 mm

Seed width min6 mm

Life cycle & reproduction11

Deciduousnessevergreen

Dispersal typewind

Flowering timennyyyynnnnnn

Life formshrub

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproduction asexualabsent

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment15

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 000 m

Elevation min100 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typefollicle

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree · TRY: shrub

Habitat GIFTLowland

Leaf compoundnesscompound simple

Leaf shapeterete

Mycorrhizapresent

Mycorrhiza typenon-ectomycorrhizal

Woodinesswoody

Physiology & chemistry5

Leaf n4.41 mg/g

Leaf p0.21 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)2.41 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hakea drupacea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOQ446962.1 ↗553 bpSouth Africa · 2020

ACGT

AAGTGTCGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACGGATATCTTGGCAGC …

Hakea drupacea isolate 6145681 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1

plant barcode

08Occurrence & distribution

Record type763 records

Wild obs. + sensor545

Museum / vouchered213

Cultivated / captive5

Origin

Native11

Introduced105

Range

Area of Occupancy AOO1 576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 413≤1 km 52≤10 km 19>10 km 3

487 georeferenced · 58 without coordinates

Open the mapobservation + sensor545

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 17≤1 km 23≤10 km 64>10 km 30

134 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence213

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 4 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	56
Canberra, AU	24
Museo Entomologico de Leonlocation not on record	22
Mount Annan, AU	20
Pretoria, ZA	20
Cape Town, ZA	16
Adelaide, AU	13
Auckland, NZ	11
BGPAlocation not on record	11
Rotorua, NZ	3
Brisbane, AU	2
Hobart, AU	2
Christchurch, NZ	2
Canadian Department of Agriculturelocation not on record	2
Palmerston, AU	2
Armidale, AU	1
LDlocation not on record	1

17 institutions · 208 of 213 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Hakea drupacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)