Hakea decurrens

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Hakea

At a glance

Occurrence records2 532

Data sources5

Biological traits41

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Hakea decurrens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 532 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources41 traits

Occurrence & distributionGBIF2 532 records

DNA & barcodingNCBIsequences

01Narrative

Hakea decurrens (лат.) — кустарник или небольшое дерево, вид рода Хакея (Hakea) семейства Протейные (Proteaceae). Цветёт с мая по сентябрь. Известны три подвида.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length26.5 mm

Fruit width22 mm

Leaf length45 mm

Leaf length max1.6 mm

Leaf length min0.7 mm

Leaf width1 mm

Leaf width max1.6 mm

Leaf width min0.7 mm

Plant height3 m

Plant height max5 m

Plant height min0.3 m

Seed length20 mm

Seed mass26.45 mg

⚠ sources differ — TRY: 26.45 mg · AusTraits: 24.35 mg · GIFT: 25.2 mg

Seed mass max25.2 mg

Seed mass min25.2 mg

Seed width8.5 mm

Life cycle & reproduction10

Deciduousnessevergreen

Dispersal typewind

Flowering endSep

Flowering startJun

Flowering timennnnnyyyynnn

Life formsubshrub, shrub or tree

Life spanperennial

Pollination syndromeinsect+vertebrate

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typefollicle

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree · TRY: ST

Leaf compoundnesssimple

Leaf shapeterete

Woodinesswoody

Physiology & chemistry4

Leaf n7.3 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)3.7 mm²/mg

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hakea decurrens has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOR352984.1 ↗553 bpNew Zealand · 2021

ACGT

AAGTGTCGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACGGATATCTTGGCAGC …

Hakea decurrens isolate NPPO-NL ref. no. 6143694 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL6

plant barcode

08Occurrence & distribution

Record type2 532 records

Wild obs. + sensor2 388

Museum / vouchered142

Cultivated / captive2

Origin

Native7

Introduced1

Range

Area of Occupancy AOO4 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 1 239≤1 km 379≤10 km 66>10 km 43

1 727 georeferenced · 661 without coordinates

Open the mapobservation + sensor2 388

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 8≤1 km 15≤10 km 20>10 km 2

45 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence142

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	12
Museo Entomologico de Leonlocation not on record	9
Canberra, AU	8
Mount Annan, AU	6
Christchurch, NZ	6
Stockholm, SE	3
Parkville, AU	3
Brisbane, AU	3
Kew, GB	3
QVMAGlocation not on record	3
John T. Waterhouse Herbariumlocation not on record	2
Hobart, AU	2
La Trobe Universitylocation not on record	2
Wollongong, AU	1
Armidale, AU	1
Smithfield, AU	1
Palmerston, AU	1

17 institutions · 66 of 142 vouchered records shown · 76 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hakea decurrens

At a glance

Sources5 archives

Size & morphology16

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

At a glance

Record type2 532 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 17 geolocated

Cultivated / Captivenot free-living

Record type2 532 records