Hakea cucullata

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Hakea

At a glance

Occurrence records348

Data sources8

Biological traits34

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Hakea cucullata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility348 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF348 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Хакея клобучковая — растение; вид рода Хакея семейства Протейные, эндемик юго-западной части штата Западная Австралия (Австралия). Представляет собой прямостоящий кустарник с редкими ветвями и характерными яйцеобразными листьями, которые почти полностью обернуты вокруг стебля, цветков и плодов.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length27.5 mm

Fruit width17 mm

Leaf length57.5 mm

Leaf mass per area324 g/m2

Leaf size1 043 mm²

Leaf width56.5 mm

Plant height4 m

⚠ sources differ — AusTraits: 4 m · TRY: 2 m

Plant height max4 m

Plant height min1 m

Seed length17.5 mm

Seed mass27.96 mg

⚠ sources differ — TRY: 27.96 mg · AusTraits: 26.39 mg · GIFT: 29 mg

Seed mass max29 mg

Seed mass min29 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timennnnyyyyyyyn

Life formshrub or tree

Life spanperennial

Pollination syndromebird

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Fruit fleshinessdry

Fruit typefollicle

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub · TRY: shrub

Leaf compoundnesscompound

Leaf shapecordate orbicular widely_obovate

Mycorrhiza typenon-ectomycorrhizal

Woodinesswoody

Physiology & chemistry4

Leaf n6.59 mg/g

Leaf p0.2 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)3.09 mm²/mg

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hakea cucullata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLKJ872886.1 ↗442 bp

ACGT

AAGGCCCGCCTCATGGTATCCAAGTTGAGAGGGATAAATTGAACAAATATGGTCGACCCCTATTGGGATGTACTATTAAACCAAAATTGG …

Hakea cucullata ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type348 records

Wild obs. + sensor218

Museum / vouchered126

Cultivated / captive4

Origin

Native14

Range

Area of Occupancy AOO708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 90≤1 km 35≤10 km 17>10 km 20

162 georeferenced · 56 without coordinates

Open the mapobservation + sensor218

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 14≤1 km 5≤10 km 63>10 km 23

105 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence126

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1≤10 km 1

3 georeferenced · 1 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	56
Mount Annan, AU	16
Museo Entomologico de Leonlocation not on record	16
Canberra, AU	14
Adelaide, AU	4
Brisbane, AU	3
South Kensington, GB	3
BGPAlocation not on record	3
Claremont, US	2
Auckland, NZ	2
LDlocation not on record	2
Museo Nacional de Costa Rica (MNCR)location not on record	1
Armidale, AU	1
Palmerston, AU	1
Smithfield, AU	1

15 institutions · 125 of 126 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Hakea cucullata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)