Hakea actites

W.R.Barker · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Hakea

At a glance

Occurrence records887

Data sources8

Biological traits39

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Hakea actites's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility887 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources39 traits

Occurrence & distributionGBIF887 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Hakea actites, commonly known as the mulloway needle bush or wallum hakea is a shrub or tree of the Proteacea family native to areas in north eastern New South Wales and south eastern Queensland. White nectar rich flowers appear in abundance from late autumn to early spring.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology18

Fruit length28 mm

Fruit width20.5 mm

Leaf length80 mm

Leaf length max1.3 mm

Leaf length min0.8 mm

Leaf mass per area316 g/m2

Leaf size137 mm²

Leaf width1.05 mm

Leaf width max1.3 mm

Leaf width min0.8 mm

Plant height2.65 m

Plant height max5 m

Plant height min0.3 m

Seed length20.5 mm

Seed mass47.07 mg

⚠ sources differ — TRY: 47.07 mg · AusTraits: 40.64 mg · GIFT: 47.07 mg

Seed mass max73.79 mg

Seed mass min26.79 mg

Seed width1 mm

Life cycle & reproduction7

Deciduousnessevergreen

Flowering endSep

Flowering startMay

Flowering timennnnyyyyynnn

Life formsubshrub, shrub or tree

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typefollicle

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapeterete

Woodinesswoody

Physiology & chemistry3

Photosynthetic pathwayC3

Specific leaf area (SLA)3.24 mm²/mg

Wood density514 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hakea actites has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON594240.1 ↗327 bpAustralia · 2018

ACGT

CCGGGAGTTCCGCCTGAGGAAGCGGGGGCAGCGGTAGCTGCCGAATCTTCGANTGGTACATGGACAACTGTGTGGACCGATGGACTTACC …

Hakea actites voucher 600300362 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1trnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type887 records

Wild obs. + sensor559

Museum / vouchered195

Cultivated / captive4

Other129

Origin

Native30

Range

Area of Occupancy AOO1 584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 341≤1 km 63≤10 km 22>10 km 15

441 georeferenced · 118 without coordinates

Open the mapobservation + sensor559

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 33≤1 km 24≤10 km 77>10 km 35

169 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence195

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy67% within 1 km

≤100 m 2≤10 km 1

3 georeferenced · 1 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	82
Canberra, AU	36
Mount Annan, AU	30
Armidale, AU	15
Adelaide, AU	14
Museo Entomologico de Leonlocation not on record	7
John T. Waterhouse Herbariumlocation not on record	4
Wellington, NZ	1
Hobart, AU	1
Kew, GB	1
University of the Sunshine Coastlocation not on record	1
Smithfield, AU	1

12 institutions · 193 of 195 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Hakea actites was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 16.6–16.6

Seasonal swing summer↔winter8.90 °C

Max temp (day)20.4 °C

Min temp (night)13.4 °C

Precipitation67.3 mm/mo

Air humidity54.7 %

Moisture balance-20.7 mm/mo

Vapour deficit854 Pa

Wind speed2.30 m/s

Cloud cover23.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)