Hagenia abyssinica

(Bruce) J.F.Gmel. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Hagenia

At a glance

Occurrence records499

Data sources10

Biological traits23

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Hagenia abyssinica's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility499 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Chemical compositionLOTUS23 compounds

Occurrence & distributionGBIF499 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Hagenia is a monotypic genus of flowering plant with the sole species Hagenia abyssinica, native to the high-elevation Afromontane regions of central and eastern Africa. It also has a disjunct distribution in the high mountains of East Africa from Sudan and Ethiopia in the north, through Kenya, Uganda, Rwanda, Burundi, Democratic Republic of Congo, and Tanzania, to Malawi and Zambia in the south. A member of the rose family, its closest relative is the Afromontane genus Leucosidea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height15 m

⚠ sources differ — GIFT: 15 m · TRY: 7.49 m

Seed mass2 102 mg

Seed mass max4 202 mg

Seed mass min2.5 mg

Life cycle & reproduction7

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatemontane tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Angiosperm

Habitat GIFTLowland

Mycorrhiza type0.00000375

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)300 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density538 mg/cm³

03Chemical composition23 compounds

Compounds documented for Hagenia abyssinica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Dimeric phloroglucinols9

Acyl phloroglucinols6

Oligomeric phloroglucinols (phlorotannins)4

Simple phenolic acids2

Cinnamic acids and derivatives $ Simple phenolic acids1

Documented compounds23 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-1-[3,5-bis[[2,6-dihydroxy-4-methoxy-3-methyl-5-[(2R)-2-methylbutanoyl]phenyl]methyl]-2,4,6-trihydroxyphenyl]-2-methylbutan-1-one	present	LOTUS
(2R,6S)-2,6-bis[[2,6-dihydroxy-4-methoxy-3-methyl-5-(2-methylpropanoyl)phenyl]methyl]-5-hydroxy-2,6-dimethyl-4-(2-methylpropanoyl)cyclohex-4-ene-1,3-dione	present	LOTUS
(2S,6S)-6-[[2,6-dihydroxy-4-methoxy-3-methyl-5-[(2R)-2-methylbutanoyl]phenyl]methyl]-2-[[2,6-dihydroxy-4-methoxy-3-methyl-5-(3-methylbutanoyl)phenyl]methyl]-5-hydroxy-2,6-dimethyl-4-(3-methylbutanoyl)cyclohex-4-ene-1,3-dione	present	LOTUS
1-(2,4-Dihydroxy-6-methoxy-3,5-dimethylphenyl)butan-1-one	present	LOTUS
1-[3,5-Bis[[2,6-dihydroxy-4-methoxy-3-methyl-5-(2-methylpropanoyl)phenyl]methyl]-2,4,6-trihydroxyphenyl]-2-methylpropan-1-one	present	LOTUS
1-[3,5-Bis[[2,6-dihydroxy-4-methoxy-3-methyl-5-(3-methylbutanoyl)phenyl]methyl]-2,4,6-trihydroxyphenyl]-3-methylbutan-1-one	present	LOTUS
1-[3-[[2,6-Dihydroxy-4-methoxy-3-methyl-5-(2-methylpropanoyl)phenyl]methyl]-2,4-dihydroxy-6-methoxy-5-methylphenyl]-3-methylbutan-1-one	present	LOTUS
1-[3-[[2,6-Dihydroxy-4-methoxy-3-methyl-5-(3-methylbutanoyl)phenyl]methyl]-2,4-dihydroxy-6-methoxy-5-methylphenyl]-3-methylbutan-1-one	present	LOTUS
2,6-Bis[[2,6-dihydroxy-4-methoxy-3-methyl-5-(2-methylpropanoyl)phenyl]methyl]-5-hydroxy-2,6-dimethyl-4-(2-methylpropanoyl)cyclohex-4-ene-1,3-dione	present	LOTUS
2,6-Dihydroxy-3-isobutyryl-4-methoxy-5-methylbenzaldehyde	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hagenia abyssinica has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes4

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSU90800.1 ↗590 bp

ACGT

TCGAAACCTGCAGGCAGAGCGACCCCAAACACTATCACGCTCGGGGGCGGAGGGGCCTTCGCGGCCCCTCCCCGCATTCGGGAGGCGAGA …

Hagenia abyssinica internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence, and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type499 records

Wild obs. + sensor265

Museum / vouchered233

Cultivated / captive1

Origin

Introduced1

Range

Area of Occupancy AOO960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 78≤1 km 36≤10 km 12>10 km 15

141 georeferenced · 124 without coordinates

Open the mapobservation + sensor265

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 2≤1 km 5≤10 km 3

10 georeferenced · 223 without coordinates

Open the institutions mapphysical evidence233

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	32
MeiseBGlocation not on record	26
Kew, GB	22
Moscow State Universitylocation not on record	13
University of Stellenboschlocation not on record	13
Adam Mickiewicz University in Poznańlocation not on record	11
TAFORI-LSRClocation not on record	9
Stockholm, SE	6
Auckland, NZ	6
Rotorua, NZ	5
Uppsala, SE	3
Arusha, TZ	3
Christchurch, NZ	3
Bronx, US	2
Bloomington, US	2
Pretoria, ZA	2
Wellington, NZ	2
Xiamen, CN	2
Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record	2
Southern Highlands Conservation Programmelocation not on record	1
Chicago, US	1
MHUlocation not on record	1
CRSN_LWIROlocation not on record	1
Museum of the Rockieslocation not on record	1
CJBGlocation not on record	1
Riverside, US	1
Frankfurt am Main	1
TFDlocation not on record	1
EAlocation not on record	1
Hobart, AU	1
Shanghai Chenshan Botanical Gardenlocation not on record	1
Trondheim, NO	1
MAlocation not on record	1
Santa Barbara, US	1
South Kensington, GB	1

35 institutions · 180 of 233 vouchered records shown · 53 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Hagenia abyssinica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)