Haemodorum tenuifolium

A.Cunn. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Haemodoraceae/Haemodorum

At a glance

Occurrence records218

Data sources7

Biological traits31

DNA specimens4

eDNA detections2

Sources7 archives

Databases and archives Haemodorum tenuifolium's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility218 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF218 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Haemodorum tenuifolium is a shrub native to southeastern Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length8 mm

Leaf length425 mm

Leaf length max2 mm

Leaf length min1 mm

Leaf width1.4 mm

Leaf width max2 mm

Leaf width min1 mm

Plant height0.55 m

Plant height max0.8 m

Plant height min0.3 m

Seed mass23.5 mg

⚠ sources differ — TRY: 23.5 mg · AusTraits: 15.01 mg · GIFT: 23.5 mg

Seed mass max23.5 mg

Seed mass min23.5 mg

Life cycle & reproduction6

Dehiscencedehiscent

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeterete

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Haemodorum tenuifolium has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON594239.1 ↗591 bpAustralia · 2017

ACGT

GACATGTCACCACAAACAGAGACTAAAGCAAGTGCTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTAT …

Haemodorum tenuifolium voucher 600300322 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2trnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type218 records

Wild obs. + sensor107

Museum / vouchered76

Cultivated / captive1

Other34

Origin

Native13

Range

Area of Occupancy AOO552 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 63≤1 km 8≤10 km 10>10 km 4

85 georeferenced · 22 without coordinates

Open the mapobservation + sensor107

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 19≤1 km 4≤10 km 23>10 km 17

63 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence76

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	43
Mount Annan, AU	13
Museo Entomologico de Leonlocation not on record	6
Kew, GB	3
Canberra, AU	3
Kensington, AU	2
Armidale, AU	2
John T. Waterhouse Herbariumlocation not on record	1
University of the Sunshine Coastlocation not on record	1

9 institutions · 74 of 76 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Haemodorum tenuifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 19.2–19.2

Seasonal swing summer↔winter8.90 °C

Max temp (day)22.7 °C

Min temp (night)16.0 °C

Precipitation57.9 mm/mo

Air humidity56.6 %

Moisture balance-89.8 mm/mo

Vapour deficit959 Pa

Wind speed5.00 m/s

Cloud cover18.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)