Haemodorum spicatum

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Haemodoraceae/Haemodorum

At a glance

Occurrence records445

Data sources8

Biological traits31

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Haemodorum spicatum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility445 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Chemical compositionLOTUS · NPASS10 compounds

Occurrence & distributionGBIF445 records

DNA & barcodingNCBIsequences

01Narrative

Haemodorum spicatum is a plant in the Haemodoraceae family native to south Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Leaf length445 mm

Leaf width2 mm

Plant height2 m

Plant height max2 m

Plant height min0.3 m

Seed mass4.26 mg

Seed mass max4.26 mg

Seed mass min4.26 mg

Seed volume4 mm³

Seed volume max4 mm³

Seed volume min4 mm³

Life cycle & reproduction6

Flowering timeynnnnnnyyyyy

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeterete

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition10 compounds

Compounds documented for Haemodorum spicatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Phenanthrenes8

Naphthoquinones6

Aporphine alkaloids $ Naphthoquinones2

Neoflavonoids2

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
10,14-Dimethoxy-8-oxapentacyclo[10.6.2.02,7.09,19.016,20]icosa-1(19),2,4,6,9,11,13,16(20),17-nonaen-15-one	present	LOTUS
10-Hydroxy-8-oxapentacyclo[10.6.2.02,7.09,19.016,20]icosa-1(19),2,4,6,9,11,13,16(20),17-nonaen-15-one	present	LOTUS
2,5,6-Trimethoxy-9-phenyl-1H-phenalen-1-one	present	LOTUS
2,6-Dimethoxy-9-phenylphenalen-1-one	present	LOTUS
2-Hydroxy-4,6-dimethoxy-9-phenylphenalen-1-one	present	LOTUS
5-Hydroxy-2,6-dimethoxy-9-phenylphenalen-1-one	present	LOTUS
5-Hydroxy-2-methoxy-6-oxa-benzo[def]chrysen-1-one	present	LOTUS
5-Methoxy-6-oxa-benzo[def]chrysen-1-one	present	LOTUS
7,8-Dihydroxy-4-methoxy-10-phenyl-3-oxatricyclo[7.3.1.05,13]trideca-1(13),5,7,9,11-pentaen-2-one	present	LOTUS
7-Methoxy-10-phenyl-2-oxatricyclo[7.3.1.05,13]trideca-1(13),4,6,9,11-pentaene-3,8-dione	present	LOTUS

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Haemodorum spicatum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences8

The DNA barcodea real sequence read deposited for this species

rbcLPP963746.1 ↗1 275 bp

ACGT

GGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAA …

Haemodorum spicatum RJS132 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4

plant barcode

08Occurrence & distribution

Record type445 records

Wild obs. + sensor265

Museum / vouchered178

Cultivated / captive2

Origin

Native29

Range

Area of Occupancy AOO1 244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 171≤1 km 41≤10 km 9>10 km 10

231 georeferenced · 34 without coordinates

Open the mapobservation + sensor265

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 37≤1 km 11≤10 km 39>10 km 10

97 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence178

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	143
BGPAlocation not on record	9
Mount Annan, AU	8
Museo Entomologico de Leonlocation not on record	5
Canberra, AU	4
Joondalup, AU	2
Brisbane, AU	2
Hobart, AU	1
Armidale, AU	1
LDlocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
Adelaide, AU	1

12 institutions · 178 of 178 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)