Haemodorum brevisepalum

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Haemodoraceae/Haemodorum

At a glance

Occurrence records47

Data sources5

Biological traits23

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Haemodorum brevisepalum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF47 records

DNA & barcodingNCBIsequences

01Narrative

Haemodorum brevisepalum is a shrub in the Haemodoraceae family, native to southwestern Western Australia. It was first described in 1873 by George Bentham.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Leaf length205 mm

Leaf width1 mm

Plant height0.215 m

Plant height max0.35 m

Plant height min0.08 m

Seed mass2.46 mg

Life cycle & reproduction5

Flowering timennnnnnnnyyyy

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeterete

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Haemodorum brevisepalum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

rbcLPP963743.1 ↗1 275 bp

ACGT

GGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAA …

Haemodorum brevisepalum RJS160 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2

plant barcode

08Occurrence & distribution

Record type47 records

Wild obs. + sensor8

Museum / vouchered39

Origin

Native2

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 4≤1 km 3>10 km 1

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 8≤1 km 3≤10 km 17>10 km 1

29 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	28
BGPAlocation not on record	4
Canberra, AU	3
Mount Annan, AU	2
Museo Entomologico de Leonlocation not on record	2

5 institutions · 39 of 39 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)