Haematopota pluvialis

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tabanidae/Haematopota

At a glance

Occurrence records25 299

Data sources9

Biological traits2

DNA specimens68

eDNA detections1 084

Sources9 archives

Databases and archives Haematopota pluvialis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 299 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 084 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics68 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF25 299 records

Environmental DNA3 datasets · 13 countries1 084 detections

DNA & barcodingBOLD68 specimens

Genome at a glanceGoaT · TreeOfSex2n = 18

01Narrative

Haematopota pluvialis, the common horse fly or notch-horned cleg fly, or simply cleg in Scotland and northern parts of Ireland, is a species belonging to the family Tabanidae subfamily Tabaninae.Biolib

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)predator

05DNA & barcoding68 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Haematopota pluvialis has left across the world's sequence archives.

At a glance

DNA specimens68

BINs1

Marker genes3

eDNA detections1 084

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus56 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

49Gmostly conserved

50Cmostly conserved

85Gmostly conserved

187Tmostly conserved

202Amostly conserved

265Tmostly conserved

271Cmostly conserved

322Amostly conserved

373Amostly conserved

406Tmostly conserved

433Gmostly conserved

487Tmostly conserved

496Amostly conserved

542Tmostly conserved

562Gvariable

604Amostly conserved

616Cmostly conserved

631Amostly conserved

AACATTATACTTTATTTTTGGGGCATGAGCCGGAATAATTGGAACCTCGCTAAGTATTTTAATTCGAGCTGAATTAGGACACCCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes28

BIN1

Most divergent pair12.0%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Haematopota scutellatasame genus4.1%Haematopota italicasame genus4.7%Haematopota cilipessame genus5.8%Haematopota bigotisame genus5.8%Haematopota grandissame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Haematopota pluvialis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome records18–182n range18median18mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 187×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Altunsoy, F. and A. Y. Kilic (2010). "Karyotype characterization of some Tabanidae (Diptera) species." Turkiye Entomoloji Dergisi-Turkish Journal Of Entomology 34(4): 477-494. ↗

TreeOfSex · invert — Boyes, J. W. and A. Wilkes (1972). "Chromosomes of Tabanidae (Diptera)." Canadian Journal of Genetics and Cytology 14(1): 95-104. ↗

08Occurrence & distribution

Record type25 299 records

Wild obs. + sensor21 008

Museum / vouchered4 274

Cultivated / captive3

Fossil1

Other13

Range

Area of Occupancy AOO42 016 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 9 857≤1 km 4 239≤10 km 5 724>10 km 29

19 849 georeferenced · 1 159 without coordinates

Open the mapobservation + sensor21 008

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 1 536≤1 km 1 005≤10 km 915>10 km 20

3 476 georeferenced · 798 without coordinates

Open the institutions mapphysical evidence4 274

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	927
Helsinki, FI	796
NTNU-VMlocation not on record	537
Tromsø, NO	476
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	326
SLU Artdatabankenlocation not on record	142
Gothenburg, SE	133
Tilburg, NL	98
CBDClocation not on record	97
DFFW2018location not on record	78
NCMGlocation not on record	76
ZMAAlocation not on record	70
University of Tokyo, Department of Zoologylocation not on record	60
RMZlocation not on record	44
BioFokuslocation not on record	37
DFlocation not on record	30
DFFW2016location not on record	28
South Kensington, GB	23
NMOKlocation not on record	21
Instituto de Investigação Científica Tropicallocation not on record	19
Stockholm, SE	19
Kuopio, FI	14
Philadelphia, US	14
NHMOlocation not on record	12
neflocation not on record	11
Rovaniemi, FI	8
Metsähallituslocation not on record	6
Natural History Museum Rotterdamlocation not on record	5
East Lansing, US	5
Vancouver, CA	5
DFFW1981location not on record	5
Museu Nacional de História Natural e da Ciêncialocation not on record	4
Natural History Museum, Londonlocation not on record	4
ZSMlocation not on record	4
Paris, FR	3
SGAV-and-NHMDlocation not on record	3
Uniwersytet Łódzkilocation not on record	2
Ugentlocation not on record	2
Chiba, JP	2
Naturhistorisches Museum Wienlocation not on record	1
Tartu, EE	1
KwaZulu-Natal Museumlocation not on record	1
Radicondoli, IT	1

43 institutions · 4 150 of 4 274 vouchered records shown · 124 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 084 detections

Where the DNA of Haematopota pluvialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 084

Studies independent surveys3

Countries13

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 084 detections have coordinates

Open the map13 countries0

Lite, relativt skyggefullt strandengparti in…Garden and heatland, coastal habitatFarmland, coast and birch habitatNaer noksa skyggefull dam i nedlagt sandtak.Bog edge in alpine birch forestFen edge

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.65 3.60–8.90

Conductivity73.5 µS/cm 13.0–25,000

Organic carbon1.29 % 0.11–4.50

Water content9.93 % 4.37–29.7

Nitrate-N2.00 mg/kg 0.5–32.0

Phosphorus10.0 mg/kg 3.00–34.0

Clay6.48 % 0.91–42.8

Sand89.9 % 30.5–97.2

Depth0.1 m 0–0.2

SoilKurosolVertosolsTenosolKandosolSodosolRudosol

18 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 12.4–16.1

Seasonal swing summer↔winter15.4 °C

Max temp (day)17.5 °C 14.2–19.1

Min temp (night)10.9 °C 9.20–12.5

Precipitation68.1 mm/mo 60.6–109

Air humidity61.2 % 60.0–64.8

Moisture balance-50.8 mm/mo -66.2–28.2

Vapour deficit633 Pa 522–674

Wind speed4.20 m/s 2.90–5.80

Cloud cover46.1 % 39.0–54.9

CHELSA 1981–2010, ~9 km grid, at location & month of 1 074 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Haematopota pluvialis

At a glance

Sources9 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type25 299 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 43 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type25 299 records