Haematococcus lacustris

(Girod-Chantrans) Rostafinski · species

image placeholder — illustration coming later

Plantae/Chlorophyta/Chlorophyceae/Volvocales/Haematococcaceae/Haematococcus

At a glance

Occurrence records74

Data sources10

Biological traits2

DNA specimens19

eDNA detections22

Sources10 archives

Databases and archives Haematococcus lacustris's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility74 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS155 compounds

Occurrence & distributionGBIF74 records

Environmental DNA3 datasets · 3 countries22 detections

DNA & barcodingBOLD · NCBI19 specimens

Genome at a glanceGoaT · NCBI≈309 Mbp

01Narrative

Haematococcus pluvialis is a freshwater species of Chlorophyta from the family Haematococcaceae. This species is well known for its high content of the strong antioxidant astaxanthin, which is important in aquaculture, and cosmetics.Lorentz, R. T., and G. R. Cysewski. 2000. (00)01433-5 Commercial potential for Haematococcus microalgae as a natural source of astaxanthin. Trends Biotechnol. 18: 160-167. The high amount of astaxanthin is present in the resting cells, which are produced and rapidly accumulated when the environmental conditions become unfavorable for normal cell growth. Examples of such conditions include bright light, high salinity, and low availability of nutrients.S. Boussiba, and A. Vonshak, 1991. Astaxanthin Accumulation in the Green Alga Haematococcus pluvialis. Plant and Cell Physiology. 32: No. 7. 1077-1082 Haematococcus pluvialis is usually found in temperate regions around the world. Their resting cysts are often responsible for the blood-red colour seen in the bottom of dried out rock pools and bird baths. This colour is caused by astaxanthin which is believed to protect the resting cysts from the detrimental effect of UV-radiation, when exposed to direct sunlight.J. R. Dore, and G. R. Cysewski. 2003 Haematococcus algae meal as a source of natural astaxanthin for aquaculture feeds. Cyanotech Corporation. Hawaii.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthic

03Chemical composition155 compounds

Compounds documented for Haematococcus lacustris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Hydrocarbons8

Dammarane and Protostane triterpenoids7

Fatty alcohols7

Carotenoids (C40, β-β)5

Elemane sesquiterpenoids4

Documented compounds155 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-1(10),4-Cadinadiene	present	NPASS
(+)-alpha-Muurolene	present	NPASS
(+)-Calarene	present	NPASS
(+)-Schisandrin B	present	NPASS
(-)-alpha-Gurjunene	present	NPASS
(-)-Caryophyllene	present	NPASS
(1R,2R)-1-hydroxypropane-1,2,3-tricarboxylic acid	present	NPASS
(1R,2S,5S)-2-ethenyl-2,6,6-trimethyl-1-prop-1-en-2-ylbicyclo[3.2.0]heptane	present	NPASS
(1R,6R,7S)-2,6,8,8-tetramethyltricyclo[5.2.2.01,6]undec-2-ene	present	NPASS
(1R,6R,7S)-6,8,8-trimethyl-2-methylidenetricyclo[5.2.2.01,6]undecane	present	NPASS

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Haematococcus lacustris has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes4

GenBank sequences10

eDNA detections22

Countries7

The DNA barcodea real sequence read deposited for this species

ITSPQ471559.1 ↗577 bpArgentina · 2021

ACGT

GGGGGGAAACCTTTGCCTCAGCCGGCCACATTCCCCATTTCCCATTTTTGGGGGATGGGTGCGGTGTGCGTCGGTTGTGGTTCCCAGTCG …

Haematococcus lacustris isolate PSB2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL★ITS10★ITS1

animal barcodeplant barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Haematococcus lacustris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈309 350 987 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Haematococcus lacustris0.31 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness66.7% BUSCO

07Deep time~165 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin165 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard periods (Jurassic, Cretaceous…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. The dashed rules marked ✦ are the five great mass extinctions. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock originmass extinction

08Occurrence & distribution

Record type74 records

Wild obs. + sensor11

Museum / vouchered63

Origin

Native2

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 3

9 georeferenced · 2 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 1≤10 km 7

8 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence63

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	12
Bronx, US	5
New Haven, US	3
National Marine Biodiversity Institute of Korealocation not on record	2
Ann Arbor, US	1
Brown Universitylocation not on record	1
US	1
Mount Annan, AU	1
Minia, EG	1
Christchurch, NZ	1

10 institutions · 28 of 63 vouchered records shown · 34 without an institution code

09Environmental DNA22 detections

Where the DNA of Haematococcus lacustris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys3

Countries3

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH6.29

Conductivity38.1 µS/cm

Organic carbon0.59 %

Water content6.43 %

Phosphorus683 mg/kg

Sand60.1 %

Depth0 m

SoilLatLon out of range

1 sample with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median1.70 °C -5.30–4.40

Seasonal swing summer↔winter16.1 °C

Max temp (day)4.30 °C -3.40–6.70

Min temp (night)-1.20 °C -7.60–2.20

Precipitation56.4 mm/mo 54.5–61.2

Air humidity64.1 % 59.9–66.9

Moisture balance23.7 mm/mo

Vapour deficit285 Pa 177–309

Wind speed5.00 m/s

Cloud cover61.0 % 57.7–61.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)