Haemanthus humilis

Jacq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Haemanthus

At a glance

Occurrence records141

Data sources9

Biological traits15

DNA specimens5

eDNA detections6

Sources9 archives

Databases and archives Haemanthus humilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility141 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF141 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 16

01Narrative

زهرة الدم القصيرة هي نوع من النباتات تتبع جنس زهرة الدم من فصيلة النرجسية. تم وصف هذا النوع من النبات علمياً لأول مرة من قبل نيكولاس جوزيف فون جاكوين سنة 1804.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.34 m

Plant height min0.05 m

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 100 m

Elevation min460 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Haemanthus humilis has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences10

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR499766.1 ↗233 bpSouth Africa

ACGT

CCGAAAGGATGACTGTGAACACGTAAAGCTACTGTGGGGAGGGGGAAGGAGGTGGTGATTGCCAGCCTCCTTTGCCTCCTTGGGTGCCCC …

Haemanthus humilis subsp. hirsutus voucher NBG0125072 internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Haemanthus humilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 165×CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants · CCDB · Oberlander2016

CCDB · ipcn-api-dl — Vosa, C. G. & P. D. Marchi. 1980. Chromosome analysis of Haemanthus and Scadoxus (Amaryllidaceae). Pl. Syst. Evol. 135: 119–126.

CCDB · ipcn-api-dl — Vosa, C. G. 1984. The cytology of the genus Haemanthus L. (Amaryllidaceae). J. S. African Bot. 50: 237–259.

CCDB · book-atlas-flowering-plants — Gouws 1949

CCDB · Oberlander2016 — Vosa, 1984

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type141 records

Wild obs. + sensor141

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 66≤1 km 9≤10 km 5>10 km 9

89 georeferenced · 52 without coordinates

Open the mapobservation + sensor141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA6 detections

Where the DNA of Haemanthus humilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 23.5–23.5

Seasonal swing summer↔winter9.00 °C

Max temp (day)28.1 °C

Min temp (night)18.7 °C

Precipitation82.7 mm/mo

Air humidity59.2 %

Moisture balance-53.3 mm/mo

Vapour deficit1,178 Pa

Wind speed2.20 m/s

Cloud cover35.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)