Haegiela tatei

(F.Muell.) P.S.Short & Paul G.Wilson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Haegiela

At a glance

Occurrence records152

Data sources7

Biological traits27

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Haegiela tatei's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility152 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF152 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Haegiela is a genus of flowering plants in the family Asteraceae described as a genus in 1990.Tropicos, Haegiela P. S. Short & Paul G. Wilson There is only one known species, Haegiela tatei, native to South Australia, and Victoria.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology9

Fruit length0.7 mm

Leaf length4.25 mm

Leaf width1.5 mm

Plant height0.03 m

Plant height max0.08 m

Plant height min0.02 m

Seed mass0.03 mg

⚠ sources differ — TRY: 0.03 mg · AusTraits: 0.033 mg · GIFT: 0.03 mg

Seed mass max0.03 mg

Seed mass min0.03 mg

Life cycle & reproduction7

Dispersal typewind

Flowering timennnnnnnyyyyn

Life spanannual

Pollination syndromeinsect

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typegynomonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf shapelanceolate linear obovate ovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Haegiela tatei has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSJX564730.1 ↗714 bp

ACGT

CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCATAGCAGAACGACCCGTGAACATGTAACTACTATTAGGAAAC …

Haegiela tatei isolate ASL531 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type152 records

Wild obs. + sensor52

Museum / vouchered99

Cultivated / captive1

Origin

Native31

Range

Area of Occupancy AOO364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 13≤1 km 28≤10 km 11

52 georeferenced

Open the mapobservation + sensor52

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 18≤1 km 19≤10 km 54>10 km 6

97 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence99

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	41
Museo Entomologico de Leonlocation not on record	25
Kensington, AU	19
Canberra, AU	4
Kew, GB	1
Christchurch, NZ	1

6 institutions · 91 of 99 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Haegiela tatei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)