Hackelia velutina

(Piper) I.M.Johnst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Boraginales/Boraginaceae/Hackelia

At a glance

Occurrence records377

Data sources9

Biological traits9

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Hackelia velutina's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility377 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF377 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Hackelia velutina is a species of flowering plant in the borage family known by the common name velvet stickseed.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition6 compounds

Compounds documented for Hackelia velutina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Pyrrolizidine alkaloids6

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
3-Furancarboxylic acid, tetrahydro-3-hydroxy-2,4-dimethyl-5-oxo-, ((1R,7aR)-2,3,5,7a-tetrahydro-1-(((2Z)-2-methyl-1-oxo-2-butenyl)oxy)-1H-pyrrolizin-7-yl)methyl ester, (2R,3S,4S)-	present	LOTUS
7-Angelylretronecine	present	LOTUS
9-Angeloylretronecine	present	LOTUS
[(7R,8R)-7-[(Z)-2-methylbut-2-enoyl]oxy-5,6,7,8-tetrahydro-3H-pyrrolizin-1-yl]methyl (2S,3R,4R)-3-hydroxy-2,4-dimethyl-5-oxooxolane-3-carboxylate	present	LOTUS
[(7R,8R)-7-[(Z)-2-methylbut-2-enoyl]oxy-5,6,7,8-tetrahydro-3H-pyrrolizin-1-yl]methyl (2S,3R,4S)-3-hydroxy-2,4-dimethyl-5-oxooxolane-3-carboxylate	present	LOTUS
[(7R,8R)-7-acetyloxy-5,6,7,8-tetrahydro-3H-pyrrolizin-1-yl]methyl (2S,3R,4R)-3-hydroxy-2,4-dimethyl-5-oxooxolane-3-carboxylate	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hackelia velutina has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKU927719.1 ↗633 bp

ACGT

GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATCCTGCATAGCAGTACCACTCGCGAACAAGTTTATAAATGAA …

Hackelia velutina isolate W1921 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type377 records

Wild obs. + sensor270

Museum / vouchered107

Origin

Native1

Range

Area of Occupancy AOO844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 122≤1 km 26≤10 km 18>10 km 6

172 georeferenced · 98 without coordinates

Open the mapobservation + sensor270

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 4≤1 km 24≤10 km 42>10 km 1

71 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence107

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis, US	16
WTUlocation not on record	12
Claremont, US	9
Santa Barbara, US	7
Riverside, US	7
Wuzhou, CN	4
Arcata, US	3
San Jose, US	3
CASlocation not on record	3
Provo, US	2
Los Angeles, US	2
San Diego, US	2
Flagstaff, US	2
US	1
Long Beach, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
San Francisco, US	1
Canadian Department of Agriculturelocation not on record	1
San Luis Obispo, US	1
Angwin, US	1
Fredericton Stock Culture Collectionlocation not on record	1
Bronx, US	1
Bloomington, US	1
INFlocation not on record	1

24 institutions · 83 of 107 vouchered records shown · 24 without an institution code

09Environmental DNA1 detections

Where the DNA of Hackelia velutina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)