Hachettea austrocaledonica

Baill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Mystropetalaceae/Hachettea

At a glance

Occurrence records54

Data sources6

Biological traits3

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Hachettea austrocaledonica's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility54 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF54 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Hachettea austrocaledonica is a species of parasitic plant in the Balanophoraceae family. It is endemic to New Caledonia and the only species of the genus Hachettea.Morat, P., T. Jaffré, F. Tronchet, J. Munzinger, Y. Pillon, J. M. Veillon, and M. Chalopin (2012). The taxonomic reference base Florical and characteristics of the native vascular flora of New Caledonia. Adansonia 34 (2): 179–221. Its closest relative is Dactylanthus from New Zealand.Su, Huei-Jiun, Jer-Ming Hu, Frank E. Anderson, Joshua P. Der, and Daniel L. Nickrent. (2015) Phylogenetic Relationships of Santalales with Insights into the Origins of Holoparasitic Balanophoraceae. Taxon 64 (3): 491–506. doi:10.12705/643.2.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Habitat & environment3

Growth formherb

Habitat GIFTrain forest

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hachettea austrocaledonica has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKT763381.1 ↗817 bpNew Caledonia

ACGT

GAGTTTCGGATTGCGGTGACGTTGGTGGTTTGCTATCGATGACAATGCGGGAAGTTCATTGAACCTTATCATTTAGAGGAAGGAGAAGTC …

Hachettea austrocaledonica voucher Pillon 25 (NOU) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type54 records

Wild obs. + sensor28

Museum / vouchered26

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 11≤1 km 3≤10 km 1>10 km 2

17 georeferenced · 11 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 3

4 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	13
Moscow State Universitylocation not on record	4
Saint Louis, US	2
Stockholm, SE	1
Kew, GB	1
MeiseBGlocation not on record	1
Auckland, NZ	1

7 institutions · 23 of 26 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Hachettea austrocaledonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)