Habrobracon hebetor

(Say, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Habrobracon

At a glance

Occurrence records100

Data sources10

Biological traits0

DNA specimens280

eDNA detections174

Sources10 archives

Databases and archives Habrobracon hebetor's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility100 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI174 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics280 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF100 records

Environmental DNA2 datasets · 13 countries174 detections

DNA & barcodingBOLD280 specimens

Genome at a glanceGoaT · TreeOfSex156 Mbp

01Narrative

Habrobracon hebetor is a minute wasp of the family Braconidae that is an ectoparasitoid of several species of moth caterpillars. Well known hosts include the larval stage of Plodia interpunctella, the Indianmeal moth, the late larval stage of the Mediterranean flour moth and the almond moth, and the dried fruit moth (Cadra calidella).Biological Control of Insects Research by D. StanleyUSDA Agricultural Research Service ARS, "Bracon Hebetor Biological control agent for stored product pests", Ames Iowa. 1998. This parasitoid has been used commercially as a way to control pests without using chemical insecticides.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition7 compounds

Compounds documented for Habrobracon hebetor across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Hydrocarbons7

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
(E,E)-7,11,15-Trimethyl-3-methylene-hexadeca-1,6,10,14-tetraene	present	LOTUS
11-Ethyl-7,15-dimethyl-3-methylidenehexadeca-1,6,10,14-tetraene	present	LOTUS
7,11,15-Trimethyl-3-methylene-1,6,10,14-hexadecatetraene	present	LOTUS
Heptacosane	present	LOTUS
N-Pentacosane	present	LOTUS
N-Triacosane	present	LOTUS

05DNA & barcoding280 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Habrobracon hebetor has left across the world's sequence archives.

At a glance

DNA specimens280

BINs4

Marker genes1

eDNA detections174

Countries17

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P641 bp consensus276 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 39 variable positions, in barcode order

3Avariable

19Avariable

21Cvariable

60Tvariable

69Avariable

72Tvariable

81Avariable

87Cvariable

99Cvariable

108Avariable

151Gvariable

181Amostly conserved

186Tvariable

198Cvariable

207Tvariable

219Gvariable

240Tvariable

327Cvariable

339Tvariable

348Tvariable

350Avariable

351Cvariable

355Gvariable

360Avariable

381Tvariable

382Tvariable

384Avariable

397Avariable

405Tvariable

430Tvariable

504Tvariable

507Tvariable

517Tvariable

528Cvariable

546Gvariable

570Cvariable

582Cvariable

609Gvariable

634Cvariable

GGAATATGATCAGGAATAATCGGTTTATCAATAAGAATAATTATTCGTTTAGAATTAGGTATACCTGGAAGTATATTAGGAAATGACCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes15

BINs3

Most divergent pair7.5%

AfricaAsiaS.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Habrobracon platynotaesame genus11.0%Bracon rogerblancoisame family11.1%Bracon ninamasisaesame family11.7%Bracon josejaramilloisame family11.7%Bracon andrewwalshisame family11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Habrobracon hebetor carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size156 480 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Habrobracon hebetor0.16 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome records10–222n range20median20mode14records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 209×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Gokhman, V. E., & Quicke, D. L. (1995). The last twenty years of parasitic Hymenoptera karyology: an update and phylogenetic implications. J. Hym. Res, 4, 41-63. ↗

2n 104×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

2n 221×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type100 records

Wild obs. + sensor25

Museum / vouchered75

Origin

Introduced23

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 3≤1 km 4>10 km 2

9 georeferenced · 16 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 3

4 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence75

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MWLRlocation not on record	23
Honolulu, US	21
UVEG-ENVlocation not on record	16
New Zealand Arthropod Collectionlocation not on record	7
Landcare Research, New Zealand Arthropod Collectionlocation not on record	2
Helsinki, FI	2
Chicago, US	2

7 institutions · 73 of 75 vouchered records shown · 2 without an institution code

09Environmental DNA174 detections

Where the DNA of Habrobracon hebetor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found174

Studies independent surveys2

Countries13

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 174 detections have coordinates

Open the map13 countries0

Rice ecosystemUrban8. Desert | 8.1. Hot Desert14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 7.40–25.3

Seasonal swing summer↔winter21.1 °C

Max temp (day)18.4 °C 9.60–29.0

Min temp (night)8.20 °C 3.00–21.3

Precipitation79.6 mm/mo 4.80–344

Air humidity59.6 % 44.0–64.9

Moisture balance-38.4 mm/mo -152–263

Vapour deficit733 Pa 428–1,628

Wind speed3.70 m/s 2.00–5.80

Cloud cover36.7 % 14.2–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)