Gyrodactylus salaris

Malmberg, 1957 · species

image placeholder — illustration coming later

Animalia/Platyhelminthes/Monogenea/Gyrodactylidea/Gyrodactylidae/Gyrodactylus

At a glance

Occurrence records871

Data sources9

Biological traits2

DNA specimens188

eDNA detections166

Sources9 archives

Databases and archives Gyrodactylus salaris's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility871 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI166 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics188 specimens↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF871 records

Environmental DNA1 datasets · 6 countries166 detections

DNA & barcodingBOLD188 specimens

Genome at a glanceNCBI≈67 Mbp

01Narrative

A warning sign in Scotland Gyrodactylus salaris, commonly known as salmon fluke, is a tiny monogenean ectoparasite which lives on the body surface of freshwater fish. This leech-like parasite has been implicated in the reduction of Atlantic salmon populations in the Norwegian fjords.C.Michael Hogan. 2011. Norwegian Sea. Encyclopedia of Earth. Eds. P.Saundry & C.J.Cleveland. National Council for Science and the Environment. Washington DC It also parasitises other species, including rainbow trout. G. salaris requires fresh water, but can survive in brackish water for up to 18 hours. The parasite is 0.5 mm long, and cannot be seen with the naked eye, but it can be seen with a magnifying glass. On its posterior end is a haptor, a specialized organ for attaching to the host fish, which has sixteen hooks around its edge. The parasite is viviparous, that is, it produces live offspring. The parasites give birth to live young nearly as big as themselves and at this time, a further generation is already growing inside the neonates.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat brackishyes

Habitat saltwateryes

05DNA & barcoding188 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gyrodactylus salaris has left across the world's sequence archives.

At a glance

DNA specimens188

BINs8

Marker genes11

eDNA detections166

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 544 bp consensus57 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 82 variable positions, in barcode order

4Amostly conserved

11Cmostly conserved

36Cmostly conserved

45Cmostly conserved

48Cmostly conserved

55Amostly conserved

57Tmostly conserved

63Amostly conserved

66Amostly conserved

69Gmostly conserved

72Gmostly conserved

75Amostly conserved

78Amostly conserved

81Gmostly conserved

93Tmostly conserved

99Cmostly conserved

105Amostly conserved

108Cmostly conserved

111Amostly conserved

123Amostly conserved

124Cmostly conserved

135Cmostly conserved

138Tmostly conserved

141Tmostly conserved

144Tmostly conserved

147Tmostly conserved

153Cmostly conserved

162Cmostly conserved

168Cmostly conserved

177Amostly conserved

183Tmostly conserved

192Amostly conserved

204Tmostly conserved

210Tmostly conserved

211Cmostly conserved

213Tmostly conserved

219Amostly conserved

222Gmostly conserved

231Cmostly conserved

234Gmostly conserved

243Tmostly conserved

262Cmostly conserved

279Tmostly conserved

334Cmostly conserved

345Tmostly conserved

351Gmostly conserved

366Gmostly conserved

396Cmostly conserved

411Tmostly conserved

447Tmostly conserved

462Tmostly conserved

465Cmostly conserved

477Cmostly conserved

495Tmostly conserved

570Gmostly conserved

586Cmostly conserved

651Cmostly conserved

669Cmostly conserved

690Cmostly conserved

714Cmostly conserved

732Amostly conserved

744Amostly conserved

768Cmostly conserved

780Amostly conserved

813Tmostly conserved

843Cmostly conserved

861Amostly conserved

870Tmostly conserved

918Tmostly conserved

1056Amostly conserved

1107Tmostly conserved

1177Amostly conserved

1221Tmostly conserved

1228Cmostly conserved

1242Cmostly conserved

1266Tmostly conserved

1320Amostly conserved

1338Cmostly conserved

1344Tmostly conserved

1357Tmostly conserved

1386Tmostly conserved

1452Tmostly conserved

ATGAAATACTCATCATCTTGATTATTTACTCTAGACCACAAGCGCATCGGTATAATTTACAGAATAGTGGGGGTATGAGCGGGTTTCGTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes7

BINs5

Most divergent pair2.7%

Europe

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_008815 ↗ · 12 protein · 22 tRNA · 2 rRNA

COX3CYTBND4LND4ATP6ND2ND1ND3COX1COX2ND6ND5l-rRNAs-rRNA

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceNCBI

The complete instruction manual Gyrodactylus salaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈67 380 660 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Gyrodactylus salaris0.07 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

07Deep time~0 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin0 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type871 records

Wild obs. + sensor2

Museum / vouchered869

Range

Area of Occupancy AOO328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 869 records without

Open the institutions mapphysical evidence869

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of Guelphlocation not on record	10

1 institutions · 10 of 869 vouchered records shown · 839 without an institution code

09Environmental DNA166 detections

Where the DNA of Gyrodactylus salaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found166

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 166 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.8 °C 0.5–17.0

Seasonal swing summer↔winter26.3 °C

Max temp (day)14.6 °C 2.40–19.8

Min temp (night)8.60 °C -3.10–13.9

Precipitation88.0 mm/mo 62.2–106

Air humidity62.8 % 59.4–71.4

Moisture balance25.1 mm/mo -23.5–111

Vapour deficit518 Pa 178–752

Wind speed2.90 m/s 2.20–4.30

Cloud cover58.0 % 50.5–63.1

CHELSA 1981–2010, ~9 km grid, at location & month of 38 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)