Gyps himalayensis

Hume, 1869 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Accipitriformes/Accipitridae/Gyps

At a glance

Occurrence records48 208

Data sources9

Biological traits27

DNA specimens4

eDNA detections0

Sources9 archives

Databases and archives Gyps himalayensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

GBIFGlobal Biodiversity Information Facility48 208 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF48 208 records

DNA & barcodingBOLD4 specimens

Genome at a glanceGoaT · NCBI≈1.2 Gbp

01Narrative

The Himalayan vulture (Gyps himalayensis) or Himalayan griffon vulture is an Old World vulture native to the Himalayas and the adjoining Tibetan Plateau. It is one of the two largest Old World vultures and true raptors. It is listed as Near Threatened on the IUCN Red List. It is not to be confused with the griffon vulture, which is a similar species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONETEltonTraits

Size & morphology14

Beak depth34 mm

Beak length (culmen)82.5 mm

Beak length (nares)55.2 mm

Beak width23.5 mm

Body mass10 000 g

Body mass (female)9 000 g

Body mass (male)11 000 g

Hand-wing index35.5

Kipp's distance270 mm

SVL106 cm

Secondary length490 mm

Tail length339 mm

Tarsus length116 mm

Wing length760 mm

Life cycle & reproduction5

Egg mass258 g

Fledging age138 days

Incubation57 days

Litter size1

Litters per year1 /year

Diet & foraging4

Ground100 %

Scavenge100 %

Trophic levelscavenger

Trophic nicheScavenger

Habitat & environment4

HabitatRock

Migration1.0

Primary lifestyleTerrestrial

Range size3 859 146 km²

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gyps himalayensis has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P695 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.29%

Haplotypes2

BIN1

Most divergent pair0.43%

Where individuals differ — all 3 variable positions, in barcode order

202Gvariable

313Gvariable

541Avariable

TCTATACCTAATCTTCGGCGCTTGAGCTGGTATAGTCGGCACTGCTCTCAGCCTTCTTATCCGTGCAGAACTCGGTCAACCAGGCACTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gyps coprotheressame genus1.5%Gyps fulvussame genus2.0%Gyps africanussame genus2.4%Torgos tracheliotossame family7.9%Trigonoceps occipitalissame family8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Gyps himalayensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 190 689 946 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Gyps himalayensis1.19 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness96.6% BUSCO

08Occurrence & distribution

Record type48 208 records

Wild obs. + sensor48 195

Museum / vouchered12

Other1

Range

Area of Occupancy AOO38 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy27% within 1 km

≤100 m 400≤1 km 183≤10 km 7>10 km 1 535

2 125 georeferenced · 46 070 without coordinates

Open the mapobservation + sensor48 195

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 1≤10 km 5

6 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSMKlocation not on record	5
Ann Arbor, US	3
Cambridge, US	1
New Haven, US	1
Toronto, CA	1

5 institutions · 11 of 12 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Gyps himalayensis

At a glance

Sources9 archives

Size & morphology14

Life cycle & reproduction5

Diet & foraging4

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type48 208 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 5 geolocated

Record type48 208 records