Gymnoconia nitens

(Schwein.) F.Kern & Thurst. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Pucciniomycetes/Pucciniales/Phragmidiaceae/Gymnoconia

At a glance

Occurrence records167

Data sources7

Biological traits0

DNA specimens1

eDNA detections5

Sources7 archives

Databases and archives Gymnoconia nitens's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility167 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF167 records

Environmental DNA2 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Gymnoconia nitens is a species of rust fungus in the Phragmidiaceae family. It is a plant pathogen, and causes orange rust on various berries. The species was originally described in 1822 by mycologist Lewis David de Schweinitz as Aecidium luminatum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gymnoconia nitens has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPV780601.1 ↗730 bpUSA · 2024

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAAATAGAGTGCACTTTATTGTGGCTCAACTCTTTTTAACC …

Gymnoconia nitens isolate CA FUNDIS iNaturalist #211342480 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type167 records

Wild obs. + sensor105

Museum / vouchered62

Range

Area of Occupancy AOO588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 60≤1 km 12≤10 km 6>10 km 7

85 georeferenced · 20 without coordinates

Open the mapobservation + sensor105

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 1≤1 km 11≤10 km 32>10 km 4

48 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence62

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	44
DPIlocation not on record	4
Karlsruhe, DE	3
Mlocation not on record	1
TROMlocation not on record	1
Museo Entomologico de Leonlocation not on record	1
ILLSlocation not on record	1
PHlocation not on record	1
California State University, East Baylocation not on record	1

9 institutions · 57 of 62 vouchered records shown · 5 without an institution code

09Environmental DNA5 detections

Where the DNA of Gymnoconia nitens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH4.10 3.40–4.30

Conductivity140 µS/cm 135–236

Organic carbon4.90 % 4.58–5.38

Water content53.8 % 32.2–68.2

Nitrate-N62.0 mg/kg 46.0–86.0

Phosphorus22.5 mg/kg 15.0–31.0

Clay26.1 % 11.8–40.1

Sand39.8 % 24.6–50.4

Depth0.1 m 0–0.2

SoilDermosol

4 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 13.1–17.4

Seasonal swing summer↔winter10.9 °C

Max temp (day)23.6 °C 18.7–23.7

Min temp (night)12.0 °C 8.50–12.2

Precipitation70.6 mm/mo 56.4–71.7

Air humidity58.7 % 58.4–60.2

Moisture balance-75.1 mm/mo -84.9–-38.4

Vapour deficit824 Pa 602–827

Wind speed2.30 m/s 2.10–2.50

Cloud cover18.4 % 17.5–37.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)