Guioa comesperma — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Sapindaceae/Guioa

At a glance

Occurrence records153

Data sources8

Biological traits6

DNA specimens6

eDNA detections6

Sources8 archives

Databases and archives Guioa comesperma's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility153 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF153 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Guioa comesperma là một loài thực vật có hoa trong họ Bồ hòn. Loài này được Radlk. mô tả khoa học đầu tiên năm 1890.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraits

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment4

Climatewet tropical

Climberself-supporting

Growth formtree

Woodinesswoody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Guioa comesperma has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes1

GenBank sequences6

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJF738766.1 ↗492 bpPapua New Guinea · 2006

ACGT

GATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGGGTT …

Guioa comesperma voucher WP2D0358 ribulose-1,5-bisphophate carboxylase oxygenase (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL6

plant barcode

08Occurrence & distribution

Record type153 records

Museum / vouchered132

Other21

Origin

Native1

Range

Area of Occupancy AOO280 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 2≤1 km 2≤10 km 21

25 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence132

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	22
Honolulu, US	14
University of Stellenboschlocation not on record	8
St. Paul, US	8
Kew, GB	7
Saint Louis, US	2
Canberra, AU	2
Fort Worth, US	2
Paris, FR	1
Bronx, US	1
Mount Annan, AU	1
Museo Entomologico de Leonlocation not on record	1
BISHlocation not on record	1

13 institutions · 70 of 132 vouchered records shown · 56 without an institution code

09Environmental DNA6 detections

Where the DNA of Guioa comesperma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 22.8–22.8

Seasonal swing summer↔winter1.80 °C

Max temp (day)25.4 °C

Min temp (night)20.7 °C

Precipitation341 mm/mo

Air humidity74.2 %

Moisture balance252 mm/mo

Vapour deficit715 Pa

Wind speed2.10 m/s

Cloud cover49.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.