Guettarda scabra

(L.) Vent. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Guettarda

At a glance

Occurrence records765

Data sources11

Biological traits21

DNA specimens8

eDNA detections14

Sources11 archives

Databases and archives Guettarda scabra's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility765 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF765 records

Environmental DNA2 datasets · 2 countries14 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Геттарда шероховатая — кустарник или небольшое дерево, вид рода Геттарда (Guettarda) семейства Мареновые (Rubiaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height7.53 m

⚠ sources differ — GIFT: 7.53 m · TRY: 10.06 m

Plant height max10 m

Plant height min3 m

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typeanimal

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry6

Leaf n8.1 mg/g

Leaf p0.64 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)4.68 mm²/mg

Wood density725 mg/cm³

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Guettarda scabra has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes7

GenBank sequences10

eDNA detections14

Countries3

The DNA barcodea real sequence read deposited for this species

ITSAF323061.2 ↗598 bpBahamas

ACGT

TGACACGACCGCGAACCCGTTCAACTCTCCCGGGGAGCCGGGGAGGGAGACCTCCCCCGGCGAACCGGCGCTCCCCGCGCGCCCGTCGCG …

Guettarda scabra internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK3★rbcL4★rbcLa★ITS3★ITS2trnH-psbA

animal barcodeplant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Guettarda scabra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 441×CCDB · book-fedorov

CCDB · book-fedorov — Lewis W. H. 1962c

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type765 records

Wild obs. + sensor593

Museum / vouchered172

Range

Area of Occupancy AOO1 176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 323≤1 km 65≤10 km 30>10 km 74

492 georeferenced · 101 without coordinates

Open the mapobservation + sensor593

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤1 km 2≤10 km 23>10 km 24

49 georeferenced · 123 without coordinates

Open the institutions mapphysical evidence172

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Miami, US	57
Saint Louis, US	28
University of Stellenboschlocation not on record	20
Tampa, US	17
Kew, GB	13
Bronx, US	13
Jena Microbial Resource Collectionlocation not on record	5
LDlocation not on record	5
Berlin, DE	2
Altos de Pipe, VE	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Paris, FR	1
Madison, US	1
Long Beach, US	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Institut de Biologia Evolutiva, (CSIC-UPF)location not on record	1

16 institutions · 168 of 172 vouchered records shown · 3 without an institution code

09Environmental DNA14 detections

Where the DNA of Guettarda scabra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 23.6–23.6

Seasonal swing summer↔winter5.90 °C

Max temp (day)29.4 °C

Min temp (night)19.2 °C

Precipitation47.9 mm/mo

Air humidity57.3 %

Moisture balance-106 mm/mo

Vapour deficit1,241 Pa

Wind speed3.30 m/s

Cloud cover30.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)