Guardiola platyphylla

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Guardiola

At a glance

Occurrence records336

Data sources11

Biological traits7

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Guardiola platyphylla's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility336 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF336 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Guardiola platyphylla, the Apache plant, is a North American species of plants in the family Asteraceae, native to Mexico and the southwestern United States. It is found in northwestern Mexico (Chihuahua, Sinaloa, and Sonora) and the southwestern United States (southern Arizona).Biota of North America Program 2014 county distribution mapShreve, F. & I. L. Wiggins. 1964. Vegetation and Flora of the Sonoran Desert. Stanford University Press, StanfordSEINet, Southwestern Biodiversity, Arizona chapter, Guardiola platyphylla A. Gray photos, description, distribution map Guardiola platyphylla is a branching perennial herb or subshrub up to 100 cm tall. Leaves are opposite, thick and leathery, up to 7 cm long. One plant will produce several flower heads in a flat-topped array. Each head contains 1-5 white ray flowers surrounding 3-20 white disc flowers.Flora of North America, Guardiola platyphylla A. Gray 1853Gray, Asa. 1853. Smithsonian Contributions to Knowledge 5(6): 91. diagnosis in Latin, description and commentary in English

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition1 compounds

Compounds documented for Guardiola platyphylla across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(5S,8S)-3,8-dimethyl-5-prop-1-en-2-yl-5,6,7,8-tetrahydronaphthalene-1,2-diol		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Guardiola platyphylla has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF465858.1 ↗645 bp

ACGT

TCGAATCCTGCATAGCAGAACGACCTGTGAACTTGTACAACCAACGTGGCGTGCGGGTGTTGATATGTTTCTTTCAACCCTCGTGATGCC …

Guardiola platyphylla internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Guardiola platyphylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — FAASEN, P. V. 1978. Chromosomes of Guardiola (Compositae, Heliantheae). Phytologia 40: 21–24.

CCDB · eflora

n 124×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74

CCDB · ipcn-api-dl — FAASEN, P. V. & P. NADEAU. 1976. In IOPB chromosome number reports LI. Taxon 25: 155–164.

CCDB · ipcn-api-dl — FAASEN, P. V. 1978. Chromosomes of Guardiola (Compositae, Heliantheae). Phytologia 40: 21–24.

CCDB · ipcn-api-dl — Keil, D. J. & T. F. Stuessy. 1975. Chromosome counts of Compositae from the United States, Mexico and Guatemala. Rhodora 77: 171–195.

CCDB · book-ipcn73-74 — VAN FAASEN, P. 1973. In IOPB chromosome number reports XL. . Taxon 2'!I, 285-291.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type336 records

Wild obs. + sensor136

Museum / vouchered200

Range

Area of Occupancy AOO712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 80≤1 km 17≤10 km 5>10 km 5

107 georeferenced · 29 without coordinates

Open the mapobservation + sensor136

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 45≤1 km 17≤10 km 13>10 km 4

79 georeferenced · 121 without coordinates

Open the institutions mapphysical evidence200

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	44
Phoenix, US	26
Riverside, US	16
Hermosillo, MX	15
Mexico City, MX	14
Austin, US	11
EL PASO, US	8
San Diego, US	7
Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record	6
Saint Louis, US	6
Bronx, US	6
Flagstaff, US	5
La Paz, MX	4
San Luis Obispo, US	3
Claremont, US	3
The University of Arizonalocation not on record	3
DOI/NPS, Colonial National Historical Parklocation not on record	3
WTUlocation not on record	2
Davis, US	2
CASlocation not on record	2
Austin, US	2
Provo, US	1
USFSlocation not on record	1
Mexico City, MX	1
USONlocation not on record	1
New Haven, US	1
MeiseBGlocation not on record	1
Angwin, US	1
Culiacán, MX	1
Chongqing Museumlocation not on record	1
Miami, US	1
Moscow, US	1
Cambridge, US	1

33 institutions · 200 of 200 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Guardiola platyphylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)