Grindelia subalpina

Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Grindelia

At a glance

Occurrence records794

Data sources10

Biological traits11

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Grindelia subalpina's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility794 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Occurrence & distributionGBIF794 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 12

01Narrative

Grindelia subalpina, the subalpine gumweed, is a North American species of flowering plants in the Astereae tribe of the family Asteraceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass1 mg

⚠ sources differ — TRY: 1 mg · GIFT: 1.27 mg

Seed mass max1.53 mg

Seed mass min1 mg

Life cycle & reproduction2

Life spanBiennial

⚠ sources differ — TRY: Biennial · GIFT: biennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Grindelia subalpina has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJQ011918.1 ↗626 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCTAGGATGGTTCGGGCATTTGTTCGATCCTCCTGGCATACC …

Grindelia subalpina voucher JEPS:Moore & Moore 566 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Grindelia subalpina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 121×CCDB · eflora

CCDB · eflora

n 61×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — DUNFORD, M.P. 1970. In IOPB chromosome number reports xxv. Taxon 19: 102-113.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type794 records

Wild obs. + sensor560

Museum / vouchered234

Range

Area of Occupancy AOO1 568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 347≤1 km 69≤10 km 12>10 km 16

444 georeferenced · 116 without coordinates

Open the mapobservation + sensor560

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 1≤1 km 50≤10 km 40>10 km 3

94 georeferenced · 140 without coordinates

Open the institutions mapphysical evidence234

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Musee des Dinosaures d'Esperaza (Aude)location not on record	56
Bronx, US	55
DOI/NPS, Colonial National Historical Parklocation not on record	43
Denver, US	15
DOI/NPS, Greenbelt Parklocation not on record	13
Saint Louis, US	13
WTUlocation not on record	4
Chadron, US	4
Wuzhou, CN	3
Riverside, US	3
Albuquerque, US	3
EL PASO, US	3
Dekalb, US	2
University of Stellenboschlocation not on record	2
Chongqing Museumlocation not on record	2
Pocatello, US	1
Phoenix, US	1
Flagstaff, US	1
Montréal, CA	1
Moscow, US	1
US	1
Pullman, US	1
ASUlocation not on record	1
Grand Junction, US	1
Santa Barbara, US	1
Durango, US	1
Provo, US	1

27 institutions · 233 of 234 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Grindelia subalpina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)