Grindelia squarrosa
(Pursh) Dunal · speciesAt a glance
Occurrence records11 533
Data sources13
Biological traits31
DNA specimens25
eDNA detections17
Sources13 archives
Databases and archives Grindelia squarrosa's data was compiled from.
WikipediaWikimedia Foundation5 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility11 533 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics25 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources31 traits
Chemical compositionDukesPhytochem · LOTUS42 compounds
Occurrence & distributionGBIF11 533 records
Environmental DNA1 datasets · 3 countries17 detections
DNA & barcodingBOLD · NCBI25 specimens
Genome at a glanceCCDB2n = 12
01Narrative
Grindelia squarrosa, also known as a curly-top gumweed or curlycup gumweed, is a small North American biennial or short-lived perennial plant.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsTRYGIFT
Size & morphology10
Fruit length3 mm
Leaf length42.5 mm
Leaf size111 mm²
Leaf width12 mm
Plant height1 m
Plant height max1 m
Plant height min0.25 m
Seed mass0.883 mg
Seed mass max1.15 mg
Seed mass min0.7 mg
Life cycle & reproduction6
Deciduousnessevergreen
Flowering endSep
Flowering startJul
Life formannual, biennial or subshrub
Life spanbiennial
⚠ sources differ — TRY: biennial · AusTraits: biennial perennial · GIFT: annual
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typeachene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb subshrub · TRY: forb
Habitat GIFTopen roadsides
Leaf shapeelliptical lanceolate linear oblanceolate oblong obovate ovate spathulate
Woodinessvariable
⚠ sources differ — TRY: non-woody/woody · AusTraits: herbaceous · GIFT: non-woody
Physiology & chemistry5
Leaf c440 mg/g
Leaf dry-matter content (LDMC)244 mg/g
Leaf n16.38 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)12.9 mm²/mg
03Chemical composition42 compounds
Compounds documented for Grindelia squarrosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
💊 Medicinal use documented
Compound class profile5 classes
Germacrane sesquiterpenoids2
Drimane sesquiterpenoids2
Flavonols2
Secolabdane diterpenoids1
Labdane diterpenoids1
Documented compounds42 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| RESIN | 200,000 ppm | DukesPhytochem | |
| FAT | 196,000 ppm | DukesPhytochem | |
| PROTEIN | 138,000 ppm | DukesPhytochem | |
| ASH | 34,000 ppm | DukesPhytochem | |
| EO | 3,000 ppm | DukesPhytochem |
05DNA & barcoding25 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Grindelia squarrosa has left across the world's sequence archives.
At a glance
DNA specimens25
Marker genes7
GenBank sequences10
eDNA detections17
Countries3
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATC …
Grindelia squarrosa voucher MONT:87333 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL3★rbcLa★trnL-F★ITS4★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Grindelia squarrosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 12 n = 6
Ploidydiploid inferred
Chromosome records12–242n range12median12mode17records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1211×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · eflora +2
CCDB · ipcn-api-dl — Turner, B. L. & Z. Zhao. 1992. Documented chromosome numbers 1992: 2. Miscellaneous U.S.A. and Mexican species, mostly Asteraceae. Sida 15: 147–150.
CCDB · ipcn-api-dl — Volkova, S. A. & E. V. Boyko. 1986. Chromosome numbers in some species of Asteraceae from the southern part of the Soviet far east. Bot. Zhurn. 71: 1693.
CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1991. Chromosome numbers in some plant species from the south-west of the Komi ASSR. Bot. Žhurn. (Moscow & Leningrad) 76: 769–771.
CCDB · ipcn-api-dl — Parfitt, B. D. 1981. ln Chromosome number reports LXXI. Taxon 30: 515–516.
CCDB · book-ipcn67-71 — DUNFORD, M.P. 1971. Chromosome characteristics of Texas species of Grindelia (Compositael and some interspecific hybrids. southw. Naturalist 16: 131-142.
CCDB · eflora
CCDB · book-fedorov — Howe 1926
CCDB · book-fedorov — Raven et al. 1960
CCDB · book-fedorov — Turner, Ellison 1960
CCDB · book-fedorov — Solbrig et al. 1964
CCDB · iapt — IAPT/IOPB Chromosome Data 22
2n 246×CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 · CCDB · book-fedorov
CCDB · book-ipcn67-71 — CHOUKSANOVA, N.A., L.I. SVESHNIKOVA, & T.V. ALEXANDROVA. 1968. Data on karyology of the family Compositae Giseke. Citologija 10: 198-206.
CCDB · book-ipcn67-71 — WHITAKER, T.W . & J.A. STEYERMARK. 1935. Cytological aspects of Grindelia species. Bull. Torrey Bot. Club 62: 69-73.
CCDB · book-ipcn73-74 — KOVANDA, M. 1972. Somatic chromosome numbers for some Asteraceae. Rhodora 74: 102-116.
CCDB · book-fedorov — Raven et al. 1960
CCDB · book-fedorov — Whitaker, Steyermark ' 1935 k
CCDB · book-fedorov — UyKcaHoBa u ;t~p. 1968a
n 64×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · ipcn-api-dl — Pinkava, D. J. & D. J. Keil. 1977. Chromosome counts of Compositae from the United States and Mexico. Amer. J. Bot. 64: 680–686.
CCDB · ipcn-api-dl — Dunford, M. 1986. Chromosome relationships of diploid species of Grindelia (Compositae) from Colorado, New Mexico and adjacent areas. Amer. J. Bot. 73: 297–303.
CCDB · ipcn-api-dl — Schaack, C. G. 1983. In IOPB chromosome number reports LXXX. Taxon 32: 509.
CCDB · book-ipcn67-71 — POWELL, A.M. & s. SIKES. 1970. Chromosome numbers of some chihuahuan desert Compositae. Southw. Naturalist 15: 175-186.
n 124×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · ipcn-api-dl — Pinkava, D. J. & D. J. Keil. 1977. Chromosome counts of Compositae from the United States and Mexico. Amer. J. Bot. 64: 680–686.
CCDB · ipcn-api-dl — Love, A. & H. E. Connor. 1982. Relationships and taxonomy of New Zealand wheat grasses. New Zealand J. Bot. 20: 169–186.
CCDB · book-ipcn67-71 — DUNFORD, M.P. 1970. Triploid and tetraploid hybrids from diploid X tetraploid crosses in Grindelia (Compositael. Amer. J. Bot. 57: 856-860.
CCDB · book-ipcn67-71 — WHITAKER, T.W . & J.A. STEYERMARK. 1935. Cytological aspects of Grindelia species. Bull. Torrey Bot. Club 62: 69-73.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type11 533 records
Wild obs. + sensor9 409
Museum / vouchered2 118
Cultivated / captive1
Other5
Origin
Native72
Introduced44
Range
Area of Occupancy AOO26 012 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy92% within 1 km
≤100 m 5 814≤1 km 960≤10 km 301>10 km 274
7 349 georeferenced · 2 060 without coordinates
Open the mapobservation + sensor9 409
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy46% within 1 km
≤100 m 183≤1 km 296≤10 km 466>10 km 98
1 043 georeferenced · 1 075 without coordinates
Open the institutions mapphysical evidence2 118
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions96 of 147 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Wuzhou, CN | 222 |
| Spearfish, US | 135 |
| Denver, US | 89 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 78 |
| St. Paul, US | 72 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 60 |
| Bozeman, US | 53 |
| WTUlocation not on record | 52 |
| WINlocation not on record | 51 |
| Bronx, US | 45 |
| Moscow State Universitylocation not on record | 41 |
| Albuquerque, US | 41 |
| Moscow, US | 39 |
| Chadron, US | 37 |
| University of Alberta Museumslocation not on record | 33 |
| DOI/NPS, Greenbelt Parklocation not on record | 31 |
| Missoula, US | 28 |
| Bloomington, US | 28 |
| ASUlocation not on record | 27 |
| Pullman, US | 27 |
| Vancouver, CA | 26 |
| University of Stellenboschlocation not on record | 25 |
| Fort Worth, US | 24 |
| Flagstaff, US | 22 |
| Logan, US | 19 |
| Victoria, CA | 19 |
| Chongqing Museumlocation not on record | 19 |
| Boise, US | 15 |
| Phoenix, US | 15 |
| Saint Louis, US | 14 |
| Lincoln, US | 14 |
| Emporia, US | 13 |
| Lubbock, US | 12 |
| Caldwell, US | 12 |
| Riverside, US | 12 |
| Austin, US | 12 |
| Pocatello, US | 11 |
| Provo, US | 11 |
| Tempe, US | 11 |
| Philadelphia, US | 11 |
| US | 11 |
| Ann Arbor, US | 10 |
| Madison, US | 10 |
| San Luis Obispo, US | 10 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 9 |
| Walla Walla, US | 8 |
| Dekalb, US | 8 |
| Green Bay, US | 7 |
| Canadian Department of Agriculturelocation not on record | 7 |
| Weber State Universitylocation not on record | 7 |
| Toronto, CA | 7 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 7 |
| Juriquilla, MX | 6 |
| Durango, US | 6 |
| Orem, US | 6 |
| Tartu, EE | 6 |
| H-Dunkellocation not on record | 6 |
| Pittsburg, US | 5 |
| Chicago, US | 5 |
| USFSlocation not on record | 5 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 5 |
| Davenport, US | 5 |
| BRNUlocation not on record | 5 |
| IDElocation not on record | 4 |
| MeiseBGlocation not on record | 4 |
| Museo Entomologico de Leonlocation not on record | 4 |
| University of Lethbridgelocation not on record | 4 |
| Allentown, US | 4 |
| Mexico City, MX | 4 |
| Claremont, US | 4 |
| Whitehorse, CA | 4 |
| EL PASO, US | 4 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 4 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| Astana Botanical Gardenlocation not on record | 3 |
| Québec, CA | 3 |
| Chapingo, MX | 3 |
| USFS/BHSClocation not on record | 3 |
| Grand Junction, US | 3 |
| Northridge, US | 3 |
| Fargo, US | 3 |
| Burlington, US | 3 |
| New Haven, US | 3 |
| DULlocation not on record | 2 |
| CASlocation not on record | 2 |
| Whitewater, US | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| Mississippi State, US | 2 |
| Norfolk, US | 2 |
| Bureau of Land Managementlocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Miami, US | 2 |
| College Park, US | 2 |
| LDlocation not on record | 2 |
| Rocky Mountain Biological Laboratorylocation not on record | 2 |
| Montréal, CA | 2 |
| Angwin, US | 2 |
| Görlitz, DE | 2 |
| Turlock, US | 2 |
| Mlocation not on record | 2 |
| Baltimore, US | 2 |
| Brookings, US | 2 |
| LPMMBHlocation not on record | 1 |
| Minot State Universitylocation not on record | 1 |
| San Diego, US | 1 |
| sonstHerblocation not on record | 1 |
| Chicago, US | 1 |
| BAYLUlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Parkville, AU | 1 |
| Stockholm, SE | 1 |
| Karlsruhe, DE | 1 |
| Corvallis, US | 1 |
| Bend, US | 1 |
| Millersville, US | 1 |
| Taipei, TW | 1 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 1 |
| Beijing, CN | 1 |
| Nijmegen, NL | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| M-VascularPlantslocation not on record | 1 |
| MAlocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| Clemson, US | 1 |
| MEXUlocation not on record | 1 |
| Tacoma, US | 1 |
| Tuscaloosa, US | 1 |
| Natural History Museum of Utahlocation not on record | 1 |
| Oulu, FI | 1 |
| Internatinal Phytochemistry Research and Production Institutelocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| GZUlocation not on record | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| Cheney, US | 1 |
| Staten Island, US | 1 |
| US | 1 |
| Knoxville, US | 1 |
| Henderson, US | 1 |
| Philadelphia, US | 1 |
| Denton, US | 1 |
| Chapel Hill, US | 1 |
| Columbia, US | 1 |
| CJBGlocation not on record | 1 |
| Brussel, BE | 1 |
| Brisbane, AU | 1 |
| GB | 1 |
147 institutions · 1 820 of 2 118 vouchered records shown · 297 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA17 detections
Where the DNA of Grindelia squarrosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map3 countries0
Gardiner basin along Yell. river
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.2 °C 2.90–20.6
Seasonal swing summer↔winter28.8 °C
Max temp (day)19.3 °C 8.90–26.6
Min temp (night)8.70 °C -0.3–15.4
Precipitation51.9 mm/mo 24.2–81.4
Air humidity55.3 % 47.7–63.8
Moisture balance-45.1 mm/mo -91.2–-14.0
Vapour deficit706 Pa 376–1,105
Wind speed3.40 m/s 2.40–6.00
Cloud cover40.1 % 29.6–51.0
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.