Grevillea polybotrya

Meisn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Grevillea

At a glance

Occurrence records70

Data sources6

Biological traits28

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Grevillea polybotrya's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility70 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF70 records

DNA & barcodingNCBIsequences

01Narrative

Grevillea polybotrya là một loài thực vật có hoa trong họ Quắn hoa. Loài này được Meisn. miêu tả khoa học đầu tiên năm 1856.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Fruit length13 mm

Leaf length31 mm

Leaf mass38.2 mg

Leaf width6.5 mm

Plant height4 m

Plant height max4 m

Plant height min1 m

Seed mass17.65 mg

Seed mass max17.81 mg

Seed mass min17.81 mg

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timennnnnnnnyyyy

Life formshrub

Life spanperennial

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typefollicle

Growth formshrub

Leaf compoundnesssimple

Leaf shapeoblanceolate oblong obovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Grevillea polybotrya has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKKT454583.1 ↗1 530 bp

ACGT

ATGGAGGACTTACAAGAATATTTCAAAATAGATAGATCTCGGCAACAAGATTTCCTATATCCACTTTTCTTTCAGGAGTATATTTATACA …

Grevillea polybotrya isolate GrepolHodge1 maturase K (matK) gene, complete cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type70 records

Wild obs. + sensor4

Museum / vouchered64

Cultivated / captive2

Origin

Native4

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 2

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 12≤1 km 4≤10 km 20>10 km 7

43 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence64

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	29
BGPAlocation not on record	12
Museo Entomologico de Leonlocation not on record	8
Canberra, AU	6
Mount Annan, AU	4
Adelaide, AU	3
Brisbane, AU	2

7 institutions · 64 of 64 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)