Grevillea costata — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Grevillea

At a glance

Occurrence records31

Data sources6

Biological traits22

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Grevillea costata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF31 records

DNA & barcodingNCBIsequences

01Narrative

Grevillea costata is a species of flowering plant in the family Proteaceae and is endemic to the west of Western Australia. It is a spreading shrub with sharply-pointed, linear leaves and white flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology7

Fruit length10.25 mm

Leaf length30 mm

Leaf width1.05 mm

Plant height1.15 m

Plant height max1.5 m

Plant height min0.8 m

Seed mass19.45 mg

Life cycle & reproduction4

Flowering timennnnyyyyynnn

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typefollicle

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Grevillea costata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKKT454551.1 ↗1 530 bp

ACGT

ATGGAGGAATTACAAGAATATTTCAAAATAGATAGATCTTGGCAACAAGACTTCCTATATCCACTTTTCTTTCAGGAGTATATTTATACA …

Grevillea costata isolate Grecos2887 maturase K (matK) gene, complete cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1

plant barcode

08Occurrence & distribution

Record type31 records

Museum / vouchered29

Cultivated / captive2

Origin

Native6

Introduced4

Range

Area of Occupancy AOO56 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 29

29 georeferenced

Open the institutions mapphysical evidence29

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the mapnot free-living2

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	14
Mount Annan, AU	10
BGPAlocation not on record	2
Canberra, AU	2
Museo Entomologico de Leonlocation not on record	1

5 institutions · 29 of 29 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.