Graphosoma lineatum

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Graphosoma

At a glance

Occurrence records2 790

Data sources7

Biological traits0

DNA specimens40

eDNA detections14

Sources7 archives

Databases and archives Graphosoma lineatum's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 790 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 790 records

Environmental DNA1 datasets · 6 countries14 detections

DNA & barcodingBOLD40 specimens

01Narrative

Graphosoma lineatum is a species of shield bug in the family Pentatomidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Graphosoma lineatum has left across the world's sequence archives.

At a glance

DNA specimens40

BINs3

Marker genes2

eDNA detections14

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus37 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 55 variable positions, in barcode order

4Amostly conserved

34Amostly conserved

46Amostly conserved

55Cmostly conserved

67Cmostly conserved

70Tmostly conserved

94Cmostly conserved

103Tmostly conserved

106Tmostly conserved

118Cmostly conserved

121Cvariable

136Tmostly conserved

154Tvariable

157Tvariable

166Amostly conserved

197Tvariable

214Cvariable

223Avariable

250Tmostly conserved

253Gvariable

263Cmostly conserved

266Tmostly conserved

274Cmostly conserved

284Cmostly conserved

313Tmostly conserved

337Tmostly conserved

343Tvariable

346Cvariable

352Tmostly conserved

358Tvariable

376Cmostly conserved

400Cmostly conserved

406Cmostly conserved

407Tvariable

418Tmostly conserved

427Tmostly conserved

445Tvariable

460Cvariable

493Tmostly conserved

499Gvariable

505Cvariable

508Tmostly conserved

514Cvariable

517Tmostly conserved

526Cvariable

541Gmostly conserved

557Cmostly conserved

568Cvariable

578Tvariable

604Cmostly conserved

613Tvariable

616Cmostly conserved

637Tmostly conserved

641Cmostly conserved

643Amostly conserved

AACATTATATTTTCTATTTGGAATATGAGCAGGAATAGTAGGATCAGCTATAAGCTTAATTATTCGCATTGAATTAGGACAACCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.4%

Haplotypes11

BINs3

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Graphosoma rubrolineatumsame genus3.2%Graphosoma semipunctatumsame genus9.3%Graphosoma melanoxanthumsame genus9.6%Derula flavoguttatasame family11.2%Dalpada neoclavatasame family11.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type2 790 records

Wild obs. + sensor2 465

Museum / vouchered313

Cultivated / captive7

Other5

Origin

Native115

Range

Area of Occupancy AOO5 684 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 1 459≤1 km 182≤10 km 244>10 km 52

1 937 georeferenced · 528 without coordinates

Open the mapobservation + sensor2 465

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 16≤1 km 38≤10 km 99>10 km 1

154 georeferenced · 159 without coordinates

Open the institutions mapphysical evidence313

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	60
Natural History Museum Rotterdamlocation not on record	25
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	22
UO-CeStuBiolocation not on record	20
Muzeum Górnośląskie w Bytomiulocation not on record	20
Bonn, DE	18
Ugentlocation not on record	9
European Distributed Institute of Taxonomy (EDIT)location not on record	7
Tallinn, EE	6
ZSMlocation not on record	5
NHMOlocation not on record	5
Radicondoli, IT	4
IMEDEAlocation not on record	3
Provincia di Livornolocation not on record	2
Uniwersytet Łódzkilocation not on record	2
Barcelona, ES	1
University of Genevalocation not on record	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
MZLUlocation not on record	1
Jyväskylä, FI	1
NMOKlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
University of Central Floridalocation not on record	1

23 institutions · 216 of 313 vouchered records shown · 97 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA14 detections

Where the DNA of Graphosoma lineatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 14.5–24.2

Seasonal swing summer↔winter19.6 °C

Max temp (day)27.6 °C 18.9–30.6

Min temp (night)14.7 °C 9.30–16.2

Precipitation34.3 mm/mo 4.40–72.2

Air humidity50.5 % 39.8–58.3

Moisture balance-124 mm/mo -167–-20.6

Vapour deficit1,333 Pa 782–1,940

Wind speed2.60 m/s 2.10–4.30

Cloud cover36.3 % 10.6–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Graphosoma lineatum

At a glance

Sources7 archives

At a glance

Record type2 790 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions6 of 23 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 790 records