Gorteria corymbosa

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Gorteria

At a glance

Occurrence records79

Data sources7

Biological traits13

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Gorteria corymbosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility79 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources13 traits

Occurrence & distributionGBIF79 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Gorteria corymbosa là một loài thực vật có hoa trong họ Cúc. Loài này được DC. mô tả khoa học đầu tiên năm 1838.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology2

Plant height max0.2 m

Plant height min0.02 m

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max915 m

Elevation min100 m

Epiphyteterrestrial

Growth form detailedherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gorteria corymbosa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences6

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSJQ220279.1 ↗636 bp

ACGT

TCGAACCCTGCATAGCAGAACGACCCGCGAACACGTAACCACAATCGGGTGTCAAGGGGGACAGGCTCTAGCCGGCCAACCTTGGTGCCC …

Gorteria corymbosa voucher Bartsch1879 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6★ITS2

fungal barcode

08Occurrence & distribution

Record type79 records

Wild obs. + sensor17

Museum / vouchered62

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5≤1 km 3

8 georeferenced · 9 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3≤10 km 1

4 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence62

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	39
Stockholm, SE	5
Cape Town, ZA	4
University of Stellenboschlocation not on record	3
MeiseBGlocation not on record	2
South Kensington, GB	2
Xiamen, CN	1
Kew, GB	1

8 institutions · 57 of 62 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Gorteria corymbosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)