Goodenia lanata

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Goodeniaceae/Goodenia

At a glance

Occurrence records6 747

Data sources6

Biological traits25

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Goodenia lanata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility6 747 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF6 747 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Goodenia lanata, commonly known as trailing goodenia in Victoria and native primrose in Tasmania is a species of flowering plant in the family Goodeniaceae and is endemic to south-eastern Australia. It is a prostrate or low-lying perennial herb with hairy, egg-shaped leaves and racemes of yellow flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Fruit length6.5 mm

Leaf length45 mm

Leaf size1 649 mm²

Leaf width12.5 mm

Plant height0.2 m

Seed length3 mm

Seed mass1.86 mg

Seed width2.5 mm

Life cycle & reproduction7

Dispersal typewind

Flowering timeyyynnnnnyyyy

Life formperennial

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Habitat & environment7

Climatetemperate

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeobovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Goodenia lanata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSMN842422.1 ↗713 bp

ACGT

AGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGAACGACCCGAGAACACGTATAAAC …

Goodenia lanata voucher NY:A.Meebold6523 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 25S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Goodenia lanata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 163×CCDB · book-fedorov · CCDB · Cave1963

CCDB · book-fedorov — Jackson W. D. 1958

CCDB · book-fedorov — Peacock 1963

CCDB · Cave1963 — Peacock 1963

n 81×CCDB · Cave1963

CCDB · Cave1963 — Peacock 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type6 747 records

Wild obs. + sensor6 449

Museum / vouchered298

Origin

Native1

Range

Area of Occupancy AOO9 428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 4 779≤1 km 1 216≤10 km 195>10 km 44

6 234 georeferenced · 215 without coordinates

Open the mapobservation + sensor6 449

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 1≤1 km 111≤10 km 146>10 km 13

271 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence298

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	119
Hobart, AU	97
Adelaide, AU	18
Canberra, AU	16
QVMAGlocation not on record	15
Kew, GB	9
Parkville, AU	6
La Trobe Universitylocation not on record	6
Brisbane, AU	3
Smithfield, AU	2
Palmerston, AU	2
Zürich, CH	1
John T. Waterhouse Herbariumlocation not on record	1
Mount Annan, AU	1
Armidale, AU	1
Auckland, NZ	1

16 institutions · 298 of 298 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Goodenia lanata

At a glance

Sources6 archives

Size & morphology8

Life cycle & reproduction7

Habitat & environment7

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 747 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 16 geolocated

Record type6 747 records