Goniobranchus annulatus

(Eliot, 1904) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Chromodorididae/Goniobranchus

At a glance

Occurrence records305

Data sources10

Biological traits4

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Goniobranchus annulatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility281 records↗

OBISOcean Biodiversity Information System24 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF · OBIS305 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Goniobranchus annulatus is a species of sea slug, a very colourful dorid nudibranch, a shell-less marine gastropod mollusc in the family Chromodorididae.Bouchet, P. (2012). Goniobranchus annulatus. Accessed through: World Register of Marine Species on 2012-04-22Johnson R.F. & Gosliner T.M. (2012) Traditional taxonomic groupings mask evolutionary history: A molecular phylogeny and new classification of the chromodorid nudibranchs. PLoS ONE 7(4): e33479

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length10 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Vulnerability10

03Chemical composition1 compounds

Compounds documented for Goniobranchus annulatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Spongiane diterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
[3-Oxo-8-(1,2,5,5-tetramethyl-1,3,4,6,7,8-hexahydronaphthalen-2-yl)-2,7-dioxabicyclo[3.2.1]octan-6-yl] acetate		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Goniobranchus annulatus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P634 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.68%

Haplotypes2

BIN1

Most divergent pair0.95%

Where individuals differ — all 6 variable positions, in barcode order

46Gvariable

105Tvariable

315Cvariable

591Tvariable

606Cvariable

632Cvariable

TGATGTGGGTTAGTAGGAACTGGACTAAGTTTACTAATCCGCTTCGAATTAGGGACTGCGGGAGCCTTCCTTGGAGATGATCATTTTTAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Goniobranchus leopardussame genus11.9%Goniobranchus geometricussame genus13.2%Goniobranchus sinensissame genus13.8%Tambja morosasame order15.3%Glossodoris rufomarginatasame family15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type305 records

Wild obs. + sensor285

Museum / vouchered20

Range

Area of Occupancy AOO772 km²

Depth

0–200 m sunlit8

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 17 m · max 22 m · 8 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 83≤1 km 73≤10 km 40>10 km 48

244 georeferenced · 41 without coordinates

Open the mapobservation + sensor285

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 2≤10 km 2>10 km 1

5 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
CASlocation not on record	3

2 institutions · 8 of 20 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Goniobranchus annulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Marine

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.7 °C 26.7–26.7

Seasonal swing summer↔winter11.7 °C

Max temp (day)30.9 °C

Min temp (night)22.3 °C

Precipitation10.2 mm/mo

Air humidity57.9 %

Moisture balance-159 mm/mo

Vapour deficit1,485 Pa

Wind speed4.20 m/s

Cloud cover10.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)