Goniobranchus albonares

(Rudman, 1990) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Chromodorididae/Goniobranchus

At a glance

Occurrence records295

Data sources8

Biological traits4

DNA specimens6

eDNA detections5

Sources8 archives

Databases and archives Goniobranchus albonares's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility224 records↗

OBISOcean Biodiversity Information System71 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS295 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD6 specimens

01Narrative

Goniobranchus albonares is a species of colourful sea slug, a dorid nudibranch, a marine gastropod mollusc in the family Chromodorididae.Bouchet, P. (2015). Goniobranchus albonares (Rudman, 1990). In: MolluscaBase (2015). Accessed through: World Register of Marine Species on 2015-11-15Johnson R.F. & Gosliner T.M. (2012) Traditional taxonomic groupings mask evolutionary history: A molecular phylogeny and new classification of the chromodorid nudibranchs. PLoS ONE 7(4): e33479

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max22 m

Depth min5 m

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Goniobranchus albonares has left across the world's sequence archives.

At a glance

DNA specimens6

BINs3

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P583 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 79% of positions are identical in every specimen.

Diversity (π)8.9%

Haplotypes2

BINs3

Most divergent pair5.0%

Where individuals differ — all 125 variable positions, in barcode order

3Tvariable

5Amostly conserved

8Amostly conserved

11Amostly conserved

14Tmostly conserved

17Gmostly conserved

20Amostly conserved

21Amostly conserved

22Gmostly conserved

23Amostly conserved

26Amostly conserved

27Cvariable

29Tmostly conserved

30Amostly conserved

31Tmostly conserved

33Cmostly conserved

34Gmostly conserved

41Amostly conserved

42Cvariable

44Amostly conserved

47Amostly conserved

53Amostly conserved

63Tmostly conserved

68Tmostly conserved

74Tvariable

80Tmostly conserved

83Cmostly conserved

89Gvariable

98Tmostly conserved

101Cvariable

107Tmostly conserved

110Tmostly conserved

122Cmostly conserved

128Gmostly conserved

134Amostly conserved

137Amostly conserved

138Tmostly conserved

149Gmostly conserved

161Cmostly conserved

167Avariable

170Tmostly conserved

173Cvariable

174Cmostly conserved

177Tmostly conserved

188Tmostly conserved

194Tmostly conserved

200Cmostly conserved

230Avariable

231Cvariable

233Gmostly conserved

234Tmostly conserved

242Amostly conserved

245Tmostly conserved

252Cmostly conserved

254Gmostly conserved

255Tmostly conserved

260Gvariable

270Cvariable

287Amostly conserved

293Tmostly conserved

305Amostly conserved

308Cvariable

311Avariable

315Cvariable

317Amostly conserved

323Amostly conserved

327Gmostly conserved

329Tmostly conserved

335Cmostly conserved

338Gmostly conserved

344Cvariable

347Tmostly conserved

354Cvariable

356Gmostly conserved

365Cmostly conserved

368Cmostly conserved

369Tmostly conserved

377Amostly conserved

386Cmostly conserved

389Gvariable

392Cmostly conserved

393Cvariable

396Tmostly conserved

398Amostly conserved

401Gmostly conserved

404Cmostly conserved

413Cvariable

422Amostly conserved

431Cvariable

434Avariable

437Gmostly conserved

440Tmostly conserved

443Tmostly conserved

444Tmostly conserved

446Tmostly conserved

451Gmostly conserved

452Tvariable

455Amostly conserved

462Gmostly conserved

464Gmostly conserved

467Tmostly conserved

470Gmostly conserved

473Tmostly conserved

476Tmostly conserved

485Tmostly conserved

497Gvariable

500Cvariable

501Tmostly conserved

503Amostly conserved

506Gmostly conserved

509Tvariable

510Cvariable

521Tvariable

525Tmostly conserved

530Gmostly conserved

533Gmostly conserved

542Tvariable

545Gvariable

549Cmostly conserved

551Gmostly conserved

+5 more variable positions not shown

GATTAGTAGGAACTGGGCTAAGACTACTTATTCGTTTTGAACTAGGAACTGCAGGGGCTTTTTTAGGTGATGATCACTTTTACAATGTGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Goniobranchus reticulatussame genus15.6%Chromodoris lochisame family17.0%Verconia simplexsame family17.3%Felimida luteoroseasame family17.5%Chromodoris striatellasame family17.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type295 records

Wild obs. + sensor280

Museum / vouchered15

Range

Area of Occupancy AOO504 km²

Depth

0–200 m sunlit61

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 13 m · max 27 m · 61 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 167≤1 km 62≤10 km 26>10 km 12

267 georeferenced · 13 without coordinates

Open the mapobservation + sensor280

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 2>10 km 3

5 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	3
Sydney, AU	2
Cambridge, US	1
No Voucherlocation not on record	1
Washington, US	1
Western Australian Museumlocation not on record	1

6 institutions · 9 of 15 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Goniobranchus albonares was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 21.6–21.6

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.2 °C

Min temp (night)15.0 °C

Precipitation9.20 mm/mo

Air humidity43.9 %

Moisture balance-124 mm/mo

Vapour deficit1,452 Pa

Wind speed3.70 m/s

Cloud cover17.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)