Gonimbrasia tyrrhea

Cramer, 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Gonimbrasia

At a glance

Occurrence records254

Data sources7

Biological traits0

DNA specimens13

eDNA detections13

Sources7 archives

Databases and archives Gonimbrasia tyrrhea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility254 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF254 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD13 specimens

01Narrative

Gonimbrasia tyrrhea, the zigzag emperor moth, is a moth of the family Saturniidae. The species was first described by Pieter Cramer in 1776. It is found in central and southern Africa."Gonimbrasia tyrrhea (Cramer, 1775)". African Moths. Retrieved November 12, 2018. The wingspan is 90–120 mm. Adults are greenish grey with a white zigzag line. The larvae feed on Acacia mollissima, Malus, Fagus, Salix and Laburnum species. They do not spin silk but produce a subterranean pupae. They are matt black with greyish-blue scales and reach a length of up to 100 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gonimbrasia tyrrhea has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections13

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

40Gmostly conserved

88Amostly conserved

181Avariable

554Gmostly conserved

565Amostly conserved

AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAGTGGGAACTTCCCTAAGATTATTAATTCGAGCAGAATTAGGAACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.26%

Haplotypes3

BIN1

Most divergent pair0.76%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gonimbrasia godartisame genus4.1%Gonimbrasia congolensissame genus4.3%Gonimbrasia alcestrissame genus5.9%Gonimbrasia zambesinasame genus6.4%Gonimbrasia kafubuensissame genus7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_061326 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type254 records

Wild obs. + sensor249

Museum / vouchered5

Range

Area of Occupancy AOO652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 139≤1 km 40≤10 km 15>10 km 12

206 georeferenced · 43 without coordinates

Open the mapobservation + sensor249

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban Natural Science Museumlocation not on record	3
New Haven, US	2

2 institutions · 5 of 5 vouchered records shown

09Environmental DNA13 detections

Where the DNA of Gonimbrasia tyrrhea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 16.9–26.6

Seasonal swing summer↔winter3.70 °C

Max temp (day)26.5 °C 21.1–30.9

Min temp (night)21.2 °C 12.8–23.1

Precipitation50.6 mm/mo 22.0–112

Air humidity58.5 % 53.9–61.6

Moisture balance-95.5 mm/mo

Vapour deficit1,203 Pa 800–1,583

Wind speed3.90 m/s

Cloud cover30.8 % 13.0–38.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)