Gonimbrasia belina

Westwood, 1849 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Gonimbrasia

At a glance

Occurrence records614

Data sources9

Biological traits0

DNA specimens226

eDNA detections265

Sources9 archives

Databases and archives Gonimbrasia belina's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility614 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI265 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics226 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS27 compounds

Occurrence & distributionGBIF614 records

Environmental DNA1 datasets · 11 countries265 detections

DNA & barcodingBOLD226 specimens

01Narrative

Gonimbrasia belina is a species of emperor moth which is native to the warmer parts of southern Africa. Its large edible caterpillar, known as the mopane worm, madora, amacimbi or masontja, feeds primarily but not exclusively on mopane tree leaves. Mopane worms are an important source of protein for many in the region. The species was first described by John O. Westwood in 1849.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition27 compounds

Compounds documented for Gonimbrasia belina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Dammarane and Protostane triterpenoids6

Acyclic monoterpenoids5

Cholestane steroids1

Friedelane triterpenoids1

Oxygenated hydrocarbons1

Documented compounds27 total

Tissue Source Quantified only

Compound	Amount	Source
(2E,5R)-2-hexa-2,4-diynylidene-1,6-dioxaspiro[4.4]nona-3,7-diene	present	NPASS
(2E,5R,9R)-2-hexa-2,4-diynylidene-1,6-dioxaspiro[4.4]nona-3,7-dien-9-ol	present	NPASS
(3E,6E,8S,10R)-2,6,10-trimethyldodeca-3,6,11-triene-2,8,10-triol	present	NPASS
(3R,5S,6E,9S)-3,7,11-trimethyldodeca-1,6,10-triene-3,5,9-triol	present	NPASS
(3S,5R,8R,9R,10R,13R,14R,17R)-17-[(E,2S)-6-hydroxy-6-methylhept-4-en-2-yl]-4,4,8,10,14-pentamethyl-2,3,5,6,7,9,11,12,13,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(3S,5R,8R,9R,10R,13R,14R,17S)-17-[(4E)-6-hydroxy-6-methylhepta-1,4-dien-2-yl]-4,4,8,10,14-pentamethyl-2,3,5,6,7,9,11,12,13,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(3S,8R,9R,10R,13R,14R,17R)-10,13-dimethyl-17-[(2R)-6-methylheptan-2-yl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
2-[(Z)-4-thiophen-2-ylbut-1-en-3-ynyl]furan	present	NPASS
24-Ethylcoprostanol	present	LOTUS
[(1R,2R,6S,7R,10S)-2-(hydroxymethyl)-6,9-dimethyl-6-tricyclo[5.4.0.02,10]undec-8-enyl]methanol	present	NPASS

05DNA & barcoding226 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gonimbrasia belina has left across the world's sequence archives.

At a glance

DNA specimens226

BINs2

Marker genes1

eDNA detections265

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus225 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

15Tmostly conserved

51Amostly conserved

79Gmostly conserved

93Cvariable

192Amostly conserved

211Gmostly conserved

228Gmostly conserved

294Tmostly conserved

327Amostly conserved

339Amostly conserved

423Gmostly conserved

462Cmostly conserved

621Tvariable

627Cmostly conserved

AAAGATATTGGAACTTTATACTTTATTTTTGGAATTTGATCCGGAATAGTAGGAACTTCCTTAAGCTTATTAATTCGAGCAGAATTAGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.83%

Haplotypes13

BINs2

Most divergent pair2.2%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gonimbrasia abayanasame genus2.6%Gonimbrasia occidentalissame genus4.5%Gonimbrasia alcestrissame genus6.9%Gonimbrasia murphyianasame genus7.0%Gonimbrasia godartisame genus7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_046032 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type614 records

Wild obs. + sensor472

Museum / vouchered142

Range

Area of Occupancy AOO1 636 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 232≤1 km 87≤10 km 33>10 km 27

379 georeferenced · 93 without coordinates

Open the mapobservation + sensor472

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤1 km 5≤10 km 6>10 km 1

12 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence142

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Museums of Kenyalocation not on record	31
Durban Natural Science Museumlocation not on record	19
New Haven, US	6
Muséum d'histoire naturelle de Marseillelocation not on record	4
Auckland, NZ	1
Research Collection of Rodolphe Rougerielocation not on record	1

6 institutions · 62 of 142 vouchered records shown · 80 without an institution code

09Environmental DNA265 detections

Where the DNA of Gonimbrasia belina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found265

Studies independent surveys1

Countries11

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 265 detections have coordinates

Open the map11 countries0

Grassland/forest mosaic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 19.8–25.6

Seasonal swing summer↔winter7.40 °C

Max temp (day)28.1 °C 24.2–30.2

Min temp (night)18.7 °C 14.3–21.3

Precipitation80.9 mm/mo 25.3–163

Air humidity58.2 % 52.6–65.1

Moisture balance-78.0 mm/mo -111–22.5

Vapour deficit1,165 Pa 919–1,446

Wind speed2.90 m/s 1.70–3.80

Cloud cover33.4 % 19.1–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 47 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)