Gonidea angulata

(I.Lea, 1838) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Unionida/Unionidae/Gonidea

At a glance

Occurrence records383

Data sources6

Biological traits2

DNA specimens88

eDNA detections88

Sources6 archives

Databases and archives Gonidea angulata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility383 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI88 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics88 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF383 records

Environmental DNA1 datasets · 1 countries88 detections

DNA & barcodingBOLD88 specimens

01Narrative

Gonidea angulata, the western ridged mussel or Rocky Mountain ridged mussel, is a species of freshwater mussel, an aquatic bivalve mollusk in the family Unionidae, the river mussels. It is the only species in the genus Gonidea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthic

05DNA & barcoding88 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gonidea angulata has left across the world's sequence archives.

At a glance

DNA specimens88

BINs2

Marker genes1

eDNA detections88

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus86 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

18Gmostly conserved

42Gmostly conserved

66Avariable

228Tmostly conserved

234Gvariable

537Amostly conserved

627Amostly conserved

631Cmostly conserved

TTGTTGTTGGCTTTGTGGTCTGGGTTAATTGGGTTAGCTTTGAGATTGTTAATTCGGGCGGAGTTAGGACAACCTGGAAGATTATTAGGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes8

BIN1

Most divergent pair0.92%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Leguminaia wheatleyisame family9.9%Leguminaia saulcyisame family10.6%Microcondylaea bonelliisame family11.4%Pilsbryoconcha cariniferasame family12.3%Elliptio nigellasame family12.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type383 records

Wild obs. + sensor100

Museum / vouchered277

Fossil6

Range

Area of Occupancy AOO1 080 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 64≤1 km 16≤10 km 7>10 km 9

96 georeferenced · 4 without coordinates

Open the mapobservation + sensor100

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 21≤10 km 9>10 km 12

42 georeferenced · 235 without coordinates

Open the institutions mapphysical evidence277

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	54
Santa Barbara Museum of Natural Historylocation not on record	36
Philadelphia, US	28
Ann Arbor, US	22
The Ohio State University Museum of Biological Diversitylocation not on record	20
Cambridge, US	17
Victoria, CA	17
North Carolina Museum of Natural Scienceslocation not on record	16
Delaware Museum of Nature and Sciencelocation not on record	15
Champaign, US	14
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	13
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	6
Chicago, US	4
Los Angeles, US	4
Natural History Museum of Utahlocation not on record	3
CASlocation not on record	2
Seattle, US	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Chongqing Museumlocation not on record	1
Chicago, US	1
Toronto, CA	1

21 institutions · 277 of 277 vouchered records shown

09Environmental DNA88 detections

Where the DNA of Gonidea angulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found88

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 88 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)