Gonichthys barnesi

Whitley, 1943 · species

image placeholder — illustration coming later

Animalia/Chordata/Myctophiformes/Myctophidae/Gonichthys

At a glance

Occurrence records424

Data sources8

Biological traits6

DNA specimens6

eDNA detections6

Sources8 archives

Databases and archives Gonichthys barnesi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility229 records↗

OBISOcean Biodiversity Information System195 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS424 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Gonichthys barnesi is een straalvinnige vissensoort uit de familie van lantaarnvissen (Myctophidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1943 door Whitley.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathypelagic

Other traits3

Depth max1 000 m

Depth min0 m

Vulnerability10

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gonichthys barnesi has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

58Tmostly conserved

85Gmostly conserved

376Gmostly conserved

424Tmostly conserved

442Cmostly conserved

460Tmostly conserved

499Amostly conserved

505Cmostly conserved

515Cmostly conserved

517Gmostly conserved

611Gmostly conserved

612Amostly conserved

613Cmostly conserved

616Amostly conserved

617Gmostly conserved

618Cmostly conserved

619Amostly conserved

620Gmostly conserved

622Cmostly conserved

623Gmostly conserved

625Cmostly conserved

626Gmostly conserved

628Tmostly conserved

630Amostly conserved

631Cmostly conserved

632Cmostly conserved

634Amostly conserved

635Amostly conserved

636Tmostly conserved

637Tmostly conserved

638Cmostly conserved

640Tvariable

642Amostly conserved

644Cmostly conserved

645Amostly conserved

646Amostly conserved

647Cmostly conserved

649Tmostly conserved

650Cmostly conserved

651Tmostly conserved

CCTCTACCTAATCTTTGGTGCCTGGGCAGGGATAGTAGGAACTGCCCTCAGCCTTCTTATTCGAGCCGAACTAAGCCAGCCCGGGGCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes4

BIN1

Most divergent pair5.8%

OtherOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gonichthys coccosame genus4.6%Istiblennius bellussame order16.0%Krefftichthys anderssonisame family16.3%Decapterus tablsame order16.7%Rasbora wilpitasame order16.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type424 records

Wild obs. + sensor14

Museum / vouchered410

Origin

Native14

Range

Area of Occupancy AOO784 km²

Depth

0–200 m sunlit8

200–1000 m twilight16

1–4 km midnight7

>4 km abyssal0

median 325 m · max 3 080 m · 31 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 2≤1 km 2>10 km 2

6 georeferenced · 8 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 3≤1 km 15≤10 km 22>10 km 175

215 georeferenced · 195 without coordinates

Open the institutions mapphysical evidence410

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	86
FishBaselocation not on record	27
Zoologisches Museum Hamburglocation not on record	24
Sydney, AU	19
Los Angeles, US	14
Washington, US	13
Copenhagen, DK	13
University of California San Diegolocation not on record	7
Australian National Fish Collectionlocation not on record	6
Paris, FR	3
CASlocation not on record	1
Toronto, CA	1
CSIRO, Australian National Fish Collectionlocation not on record	1
South African Institute for Aquatic Biodiversitylocation not on record	1
Western Australian Museumlocation not on record	1

15 institutions · 217 of 410 vouchered records shown · 8 without an institution code

09Environmental DNA6 detections

Where the DNA of Gonichthys barnesi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 16.2–17.9

Seasonal swing summer↔winter5.50 °C

Max temp (day)18.1 °C 16.8–18.5

Min temp (night)16.9 °C 15.5–17.2

Precipitation24.0 mm/mo 19.1–84.4

Air humidity58.2 % 58.1–58.4

Vapour deficit832 Pa 767–851

Cloud cover41.0 % 38.6–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)