Gonatus fabricii

(Lichtenstein, 1818) · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Oegopsida/Gonatidae/Gonatus

At a glance

Occurrence records4 289

Data sources10

Biological traits8

DNA specimens57

eDNA detections2

Sources10 archives

Databases and archives Gonatus fabricii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 228 records↗

OBISOcean Biodiversity Information System3 061 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS4 289 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD57 specimens

01Narrative

Gonatus fabricii, the Boreo-atlantic Armhook Squid, is a squid in the family Gonatidae. It occurs in the northern Atlantic Ocean from Canada to the Barents Sea. Until 1981, the name G. fabricii was usually misapplied to the very similar relative G. steenstrupi. G. fabricii grows to 30 cm in mantle length.Roper, C.F.E., M.J. Sweeney & C.E. Nauen 1984. Cephalopods of the world. Food and Agriculture Organization, Rome, Italy. The type specimen was collected off Greenland and is deposited at the Zoologisk Museum of Kobenhavns Universitet in Copenhagen.Current Classification of Recent Cephalopoda

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length38.5 cm

Life cycle & reproduction1

Max. longevity36 months

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Uses & economy1

Commercial importanceof potential interest

Other traits3

Depth max2 700 m

Depth min0 m

Vulnerability20

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gonatus fabricii has left across the world's sequence archives.

At a glance

DNA specimens57

BINs1

Marker genes2

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus55 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

50Cmostly conserved

337Amostly conserved

CACATTATACTTTATCTTTGGTATTTGAGCAGGCCTGCTAGGGACCTCCCTAAGCCTAATAATTCGAACTGAATTAGGGCAACCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes5

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gonatus californiensissame genus7.1%Gonatus berryisame genus7.3%Gonatopsis octopedatussame family8.5%Gonatus madokaisame genus8.5%Gonatopsis japonicussame family9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type4 289 records

Wild obs. + sensor3 332

Museum / vouchered296

Other661

Range

Area of Occupancy AOO11 452 km²

Depth

0–200 m sunlit890

200–1000 m twilight1 763

1–4 km midnight327

>4 km abyssal0

median 344.2 m · max 3 321.5 m · 2 980 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 17≤1 km 5>10 km 1

23 georeferenced · 3 309 without coordinates

Open the mapobservation + sensor3 332

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 293 without coordinates

Open the institutions mapphysical evidence296

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
The Atlantic reference Centrelocation not on record	71
Washington, US	39
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	21
Maurice Lamontagne Institutelocation not on record	16
Tromsø, NO	9
Delaware Museum of Nature and Sciencelocation not on record	8
Santa Barbara Museum of Natural Historylocation not on record	4
Saint John, CA	3
Victoria, CA	2
ICM-CSIClocation not on record	2
Copenhagen, DK	2
CASlocation not on record	1

12 institutions · 178 of 296 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Gonatus fabricii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Gonatus fabricii

At a glance

Sources10 archives

Size & morphology1

Life cycle & reproduction1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type4 289 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type4 289 records