Golovinomyces sordidus

(L.Junell) V.P.Heluta · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Erysiphaceae/Golovinomyces

At a glance

Occurrence records3 157

Data sources7

Biological traits0

DNA specimens12

eDNA detections13

Sources7 archives

Databases and archives Golovinomyces sordidus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 157 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 157 records

Environmental DNA2 datasets · 5 countries13 detections

DNA & barcodingBOLD · NCBI12 specimens

01Narrative

De grote weegbreemeeldauw is een echte meeldauw die voorkomt op (afgevallen) bladeren van planten uit de weegbreefamilie. Deze biotrofe parasiet komt voor op akkers en in ruigtes, bermen en parken.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Golovinomyces sordidus has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes2

GenBank sequences10

eDNA detections13

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPV416544.1 ↗539 bpUSA · 1975

ACGT

ATTACAGAGCGTGAGACTCGGCCCGGGCGTGTCCCGCGTGTCGAGTCGACCCTCCACCCGTGTTGACTTTATCTGTTGCTTTGGCGGGCC …

Golovinomyces sordidus voucher NCSLG22463 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type3 157 records

Wild obs. + sensor2 839

Museum / vouchered313

Other5

Range

Area of Occupancy AOO7 428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 1 017≤1 km 197≤10 km 1 300>10 km 26

2 540 georeferenced · 299 without coordinates

Open the mapobservation + sensor2 839

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 27≤1 km 19≤10 km 26>10 km 1

73 georeferenced · 240 without coordinates

Open the institutions mapphysical evidence313

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Karlsruhe, DE	69
Görlitz, DE	63
Helsinki, FI	49
Tartu, EE	21
WU-MYClocation not on record	19
Uniwersytet Łódzkilocation not on record	17
SLU Artdatabankenlocation not on record	13
Mlocation not on record	9
DPIlocation not on record	4
Kew, GB	3
Museo Entomologico de Leonlocation not on record	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Senckenberg Institute for Plant Form and Function at Friedrich Schiller University Jenalocation not on record	2
Oulu, FI	2
Auckland, NZ	2
San Sebastián, ES	1
MeiseBGlocation not on record	1
Universidade de Lisboa, Museu Bocagelocation not on record	1
Uppsala, SE	1
Copenhagen, DK	1
Canberra, AU	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1

22 institutions · 284 of 313 vouchered records shown · 26 without an institution code

09Environmental DNA13 detections

Where the DNA of Golovinomyces sordidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.3 °C 1.40–14.1

Seasonal swing summer↔winter19.1 °C

Max temp (day)12.8 °C 4.40–18.7

Min temp (night)7.00 °C -3.20–10.5

Precipitation67.6 mm/mo 64.2–277

Air humidity63.4 % 56.9–64.6

Moisture balance15.4 mm/mo -32.5–205

Vapour deficit479 Pa 303–717

Wind speed3.80 m/s 2.90–6.10

Cloud cover46.7 % 34.1–48.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Golovinomyces sordidus

At a glance

Sources7 archives

At a glance

Record type3 157 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 157 records