Golovinomyces brunneopunctatus

Fungi/Ascomycota/Leotiomycetes/Helotiales/Erysiphaceae/Golovinomyces

At a glance

Occurrence records7

Data sources5

Biological traits0

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Golovinomyces brunneopunctatus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility7 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 records

DNA & barcodingNCBIsequences

01Narrative

Erysiphe brunneopunctata is a plant pathogen that causes powdery mildew on monkey flower.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Golovinomyces brunneopunctatus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSON367028.1 ↗1 107 bpUSA

ACGT

ACCTGCGGAAGGATCATTACAGAGCGTGAGACTTGGCCCGGGCGTGTCCCGCGTGCCGAGTCGACCCTCCACCCGTGTTGACTTATCTCA …

Golovinomyces brunneopunctatus voucher FH00965643 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type7 records

Wild obs. + sensor6

Museum / vouchered1

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 2 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	1

1 institutions · 1 of 1 vouchered records shown