Gnorimosphaeroma oregonense

(Dana, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Isopoda/Sphaeromatidae/Gnorimosphaeroma

At a glance

Occurrence records897

Data sources9

Biological traits2

DNA specimens55

eDNA detections40

Sources9 archives

Databases and archives Gnorimosphaeroma oregonense's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility619 records↗

OBISOcean Biodiversity Information System278 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS897 records

Environmental DNA1 datasets · 2 countries40 detections

DNA & barcodingBOLD55 specimens

01Narrative

Gnorimosphaeroma oregonense, the Oregon pill bug, is a small intertidal isopod crustacean. It is an oval-shaped organism roughly 6 mm in length, and about twice as long as it is wide. The primary habitat of G. oregonense is the mid-Californian to Alaskan coast, where it inhabits tidal pools and the intertidal region up to depths of 24 m.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gnorimosphaeroma oregonense has left across the world's sequence archives.

At a glance

DNA specimens55

BINs2

Marker genes2

eDNA detections40

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

112Tmostly conserved

202Avariable

238Tmostly conserved

268Amostly conserved

322Tvariable

343Tmostly conserved

346Tmostly conserved

373Tmostly conserved

400Cmostly conserved

445Tvariable

484Gmostly conserved

496Amostly conserved

500Cmostly conserved

623Gmostly conserved

625Cmostly conserved

655Gmostly conserved

AACGATGTACTTTGTTTTCAGTAGTTGGGCAGGGATAATTGGGGCGGCGATAAGTGTGTTTATTCGGAGTGAATTAGGGCACGCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes13

BINs2

Most divergent pair2.4%

N.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type897 records

Wild obs. + sensor389

Museum / vouchered508

Range

Area of Occupancy AOO2 132 km²

Depth

0–200 m sunlit117

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0.5 m · max 20 m · 117 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 174≤1 km 33≤10 km 12>10 km 8

227 georeferenced · 162 without coordinates

Open the mapobservation + sensor389

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 8≤1 km 26≤10 km 20>10 km 19

73 georeferenced · 435 without coordinates

Open the institutions mapphysical evidence508

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	252
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	22
Natural History Museum of Los Angeles County, Marine Biodiversity Centerlocation not on record	13
Florida Museum of Natural Historylocation not on record	6
CASlocation not on record	6
Santa Barbara Museum of Natural Historylocation not on record	5
Hakai Institutelocation not on record	2
Edmonton, CA	2
Victoria, CA	1
Brussels, BE	1
RBINS-Scientific Heritagelocation not on record	1
Los Angeles, US	1
Smithsonian Institution National Museum of Natural History, Department of Invertebrate Zoologylocation not on record	1

13 institutions · 313 of 508 vouchered records shown · 17 without an institution code

09Environmental DNA40 detections

Where the DNA of Gnorimosphaeroma oregonense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map2 countries0

water temp. 18 C; 17.5 ppt; SUHH-04water temp. 18 C; 18.6 ppt; SUDM-02water temp. 18 C; 17.5 ppt; SUHH-05water temp. 18 C; 17.5 ppt; SUHH-03water temp. 25 C; 25.6 ppt; SUSH-05water temp. 18 C; 18.6 ppt; SUDM-04

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 8.40–15.9

Seasonal swing summer↔winter13.7 °C

Max temp (day)19.7 °C 9.90–20.5

Min temp (night)12.1 °C 7.10–12.4

Precipitation53.1 mm/mo 46.5–104

Air humidity59.3 % 58.7–65.8

Moisture balance-34.7 mm/mo

Vapour deficit666 Pa 443–745

Wind speed2.50 m/s

Cloud cover42.3 % 38.1–47.0

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)