Gnophos furvata

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Gnophos

At a glance

Occurrence records2 744

Data sources7

Biological traits0

DNA specimens31

eDNA detections27

Sources7 archives

Databases and archives Gnophos furvata's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 744 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 744 records

Environmental DNA1 datasets · 5 countries27 detections

DNA & barcodingBOLD31 specimens

01Narrative

Gnophos furvata is a species of moth in the family Geometridae. It is found in southern and central Europe. In the east, the range extends to the Carpathian Mountains and Ukraine. The wingspan is 38–52 mm. Adults have been recorded feeding on the nectar of Eupatorium cannabinum and Silene species. They are on wing from June to September. The larvae feed on the leaves of various plants, including Prunus spinosa, Cornus sanguinea, Clematis vitalba, Coronilla coronata and Hippocrepis comosa. The larvae can be found in late summer. The species overwinters in the larval stage. Pupation takes place in June of the following year.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gnophos furvata has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes2

eDNA detections27

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

5Cvariable

370Avariable

499Gvariable

542Cmostly conserved

AACACTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTCTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes7

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gnophos obfuscatasame genus5.8%Dyscia nobilariasame family6.7%Somatolophia cuyamasame family7.0%Petelia delostigmasame family7.1%Petelia paroobathrasame family7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCYTB

animal barcodemitochondrial

08Occurrence & distribution

Record type2 744 records

Wild obs. + sensor1 642

Museum / vouchered1 014

Other88

Origin

Native792

Range

Area of Occupancy AOO3 680 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 379≤1 km 167≤10 km 853>10 km 12

1 411 georeferenced · 231 without coordinates

Open the mapobservation + sensor1 642

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 30≤1 km 144≤10 km 798>10 km 6

978 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence1 014

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	174
Provincia di Livornolocation not on record	86
Bern, CH	85
Archäologie und Museum Baselland - Museum.BLlocation not on record	51
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	49
Dhaka, BD	35
Paro, BT	34
Tartu, EE	25
Naturama Aargaulocation not on record	24
Frauenfeld, CH	16
Musee d'Histoire Naturallelocation not on record	10
MUZOO - Musée d'histoire naturelle de La Chaux-de-Fondslocation not on record	10
Naturmuseum Solothurnlocation not on record	8
Glarus, CH	6
Nijmegen, NL	6
Fribourg, CH	6
Musée de Saint-Imierlocation not on record	6
SFRAlocation not on record	5
Muzeum Górnośląskie w Bytomiulocation not on record	4
Naturmuseum Oltenlocation not on record	4
Museum zu Allerheiligen Schaffhausenlocation not on record	4
ZSMlocation not on record	3
Research Collection of Bernd Muellerlocation not on record	3
John May Museum of Natural Historylocation not on record	3
ZMAAlocation not on record	3
Adam Mickiewicz University in Poznańlocation not on record	2
Philadelphia, US	2
Natural History Museum Rotterdamlocation not on record	2
Universität Zürich, Naturhistorisches Museumlocation not on record	2
Geneva, CH	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Sion, CH	1
Salzburg, AT	1

34 institutions · 673 of 1 014 vouchered records shown · 341 without an institution code

09Environmental DNA27 detections

Where the DNA of Gnophos furvata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 14.7–19.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)22.5 °C 18.4–24.2

Min temp (night)13.5 °C 9.00–15.1

Precipitation75.9 mm/mo 45.6–103

Air humidity56.6 % 51.8–58.6

Moisture balance-56.3 mm/mo -138–-5.90

Vapour deficit913 Pa 701–1,123

Wind speed2.80 m/s 1.70–5.10

Cloud cover33.9 % 23.3–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Gnophos furvata

At a glance

Sources7 archives

At a glance

Record type2 744 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 744 records