Gnophomyia tristissima

Osten Sacken, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Limoniidae/Gnophomyia

At a glance

Occurrence records1 439

Data sources8

Biological traits0

DNA specimens40

eDNA detections40

Sources8 archives

Databases and archives Gnophomyia tristissima's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 439 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 439 records

Environmental DNA1 datasets · 2 countries40 detections

DNA & barcodingBOLD40 specimens

01Narrative

Gnophomyia tristissima is a species of limoniid crane flies in the family Limoniidae. It is all black with yellow halteres.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gnophomyia tristissima has left across the world's sequence archives.

At a glance

DNA specimens40

BINs1

Marker genes1

eDNA detections40

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

67Tvariable

103Cmostly conserved

130Amostly conserved

181Gmostly conserved

209Tmostly conserved

214Amostly conserved

364Cmostly conserved

367Cmostly conserved

379Tmostly conserved

406Gmostly conserved

430Amostly conserved

559Gmostly conserved

625Gmostly conserved

TTTATATTTTATTTTTGGAGCCTGAGCAGGAATAGTAGGAACATCATTAAGAATTATTATTCGAGCTGAATTAGGTCATCCTGGAGCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.55%

Haplotypes5

BIN1

Most divergent pair0.92%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gnophomyia lugubrissame genus8.2%Gnophomyia acheronsame genus9.2%Gnophomyia viridipennissame genus9.8%Dicranota auripontiumsame order10.8%Gonomyia simplexsame family11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 439 records

Wild obs. + sensor1 396

Museum / vouchered43

Range

Area of Occupancy AOO3 968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 627≤1 km 268≤10 km 58>10 km 142

1 095 georeferenced · 301 without coordinates

Open the mapobservation + sensor1 396

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 2≤1 km 1≤10 km 4>10 km 1

8 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Wuzhou, CN	6
Washington, US	2
Chicago, US	1
CUlocation not on record	1
Rovaniemi, FI	1
Champaign, US	1

8 institutions · 32 of 43 vouchered records shown · 11 without an institution code

09Environmental DNA40 detections

Where the DNA of Gnophomyia tristissima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map2 countries0

Forest5. Wetlands (inland)Mixed habitatGrasslandfarm

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 16.6–23.5

Seasonal swing summer↔winter24.4 °C

Max temp (day)27.5 °C 21.7–28.6

Min temp (night)17.4 °C 11.8–18.3

Precipitation109 mm/mo 82.5–111

Air humidity58.0 % 56.8–60.0

Moisture balance-50.4 mm/mo -53.5–-26.2

Vapour deficit1,112 Pa 780–1,250

Wind speed2.50 m/s 2.00–3.50

Cloud cover36.5 % 33.3–43.8

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Gnophomyia tristissima

At a glance

Sources8 archives

At a glance

Record type1 439 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 439 records