Gnathophausia zoea

Willemoes-Suhm, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Lophogastrida/Gnathophausiidae/Gnathophausia

At a glance

Occurrence records789

Data sources7

Biological traits4

DNA specimens13

eDNA detections13

Sources7 archives

Databases and archives Gnathophausia zoea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility386 records↗

OBISOcean Biodiversity Information System403 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS789 records

Environmental DNA1 datasets · 3 countries13 detections

DNA & barcodingBOLD13 specimens

01Narrative

Gnathophausia zoea is a species of lophogastrid crustacean. It is widely distributed in the Atlantic Ocean from the Arctic Circle to the Equator; in the Pacific Ocean, it is more restricted to tropical areas. The adults may reach 40 - long, excluding the rostrum, or around 70 mm including the rostrum. This Species has also been knows as: Gnathophausia cristata Illig, 1906 (synonym); Gnathophausia sarsii Wood-Mason & Alcock, 1891 (synonym) and Gnathophausia willemoesii G.O. Sars, 1883 (synonym)http://www.marinespecies.org/photogallery.php?album=5163&pic=29532.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebathypelagic

Other traits2

Depth max6 050 m

Depth min400 m

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gnathophausia zoea has left across the world's sequence archives.

At a glance

DNA specimens13

BINs4

Marker genes2

eDNA detections13

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P622 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.16%

Where individuals differ — all 1 variable positions, in barcode order

206Cvariable

GTACCTTATATTTTATTTTAGGTATATGATCAGGAATAGTGGGGTTATCTTTAAGAATATTAATTCGAATTGAGTTAAGGCAAGCTGGTA …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type789 records

Wild obs. + sensor198

Museum / vouchered280

Other311

Origin

Native31

Range

Area of Occupancy AOO1 804 km²

Depth

0–200 m sunlit27

200–1000 m twilight150

1–4 km midnight193

>4 km abyssal12

median 1 039.6 m · max 4 825 m · 382 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 17≤1 km 6≤10 km 1>10 km 2

26 georeferenced · 172 without coordinates

Open the mapobservation + sensor198

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 12≤1 km 6≤10 km 3>10 km 4

25 georeferenced · 255 without coordinates

Open the institutions mapphysical evidence280

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
The Atlantic reference Centrelocation not on record	32
Texas Cooperative Wildlife Collectionlocation not on record	31
Washington, US	26
University of California San Diegolocation not on record	14
Cambridge, US	14
The Atlantic Reference Centre (ARC)location not on record	9
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	8
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	6
Frankfurt am Main	5
South Kensington, GB	5
Earth Sciences New Zealandlocation not on record	5
Paris, FR	5
Maurice Lamontagne Institutelocation not on record	4
730location not on record	4
New Haven, US	4
Australian National Fish Collectionlocation not on record	3
Mexico City, MX	2
IEOlocation not on record	2
Santa Barbara Museum of Natural Historylocation not on record	2
College Station, US	2
TALUDlocation not on record	2
IPMAlocation not on record	2
CASlocation not on record	1
Honolulu, US	1
ICM-CSIClocation not on record	1
TALUD, XIIlocation not on record	1

26 institutions · 191 of 280 vouchered records shown · 7 without an institution code

09Environmental DNA13 detections

Where the DNA of Gnathophausia zoea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 5.70–18.8

Seasonal swing summer↔winter18.2 °C

Max temp (day)19.2 °C 9.10–20.3

Min temp (night)17.5 °C 2.30–18.1

Precipitation111 mm/mo 47.4–115

Air humidity69.6 % 53.0–70.4

Vapour deficit623 Pa 403–721

Cloud cover39.5 % 36.9–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)