Glyceria leptostachya

Buckley · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Glyceria

At a glance

Occurrence records214

Data sources11

Biological traits11

DNA specimens4

eDNA detections3

Sources11 archives

Databases and archives Glyceria leptostachya's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility214 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF214 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Glyceria leptostachya is a species of mannagrass known by the common names davy mannagrass and narrow mannagrass.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Glyceria leptostachya has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKJ912917.1 ↗275 bpUSA · 1902

ACGT

TCGTGACCCTAACCAAAAGAGACTGTGCTCATGTCATCAACCATGCTAGAGGCGGCATTGCCTGCTGTTTGGCCAACTCCCCGACCATAT …

Glyceria leptostachya internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★rbcLa★ITS7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Glyceria leptostachya carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 401×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Fo

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type214 records

Wild obs. + sensor9

Museum / vouchered205

Range

Area of Occupancy AOO640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 7≤1 km 1

8 georeferenced · 1 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 2≤1 km 75≤10 km 32>10 km 9

118 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence205

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	35
WTUlocation not on record	35
Claremont, US	16
Victoria, CA	12
Vancouver, CA	11
Chicago, US	8
Portland, US	8
Bronx, US	8
Davis, US	8
Tacoma, US	7
Anchorage, US	7
Pullman, US	6
Ashland, US	5
Logan, US	5
Riverside, US	3
Chapel Hill, US	3
Bureau of Land Management, Medford District Officelocation not on record	2
Wuzhou, CN	2
Madison, US	2
University of British Columbia, Herbariumlocation not on record	2
Boise, US	1
Arcata, US	1
Tampa, US	1
Moscow, US	1
San Luis Obispo, US	1
Bend, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
Santa Barbara, US	1
IDElocation not on record	1
ASUlocation not on record	1
DOI/NPS, Mount Rainier National Parklocation not on record	1

31 institutions · 196 of 205 vouchered records shown · 9 without an institution code

09Environmental DNA3 detections

Where the DNA of Glyceria leptostachya was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Wet ditch along railroad tracks.Growing in 0.6 m of water on vegetated lakes…Wet grassy field where drainage collects int…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 12.9–14.6

Seasonal swing summer↔winter14.2 °C

Max temp (day)16.7 °C 16.6–20.7

Min temp (night)9.70 °C 9.30–9.90

Precipitation54.1 mm/mo 47.0–105

Air humidity59.1 % 59.1–59.6

Moisture balance-65.4 mm/mo -85.3–-12.1

Vapour deficit622 Pa 603–687

Wind speed2.80 m/s 2.00–3.20

Cloud cover39.8 % 33.3–42.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)