Gluta wallichii

(Hook.fil.) Ding Hou · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Anacardiaceae/Gluta

At a glance

Occurrence records323

Data sources9

Biological traits15

DNA specimens7

eDNA detections4

Sources9 archives

Databases and archives Gluta wallichii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility323 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF323 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Gluta wallichii là một loài thực vật có hoa trong họ Đào lộn hột. Loài này được (Hook.f.) Ding Hou mô tả khoa học đầu tiên năm 1978.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height40 m

Plant height max45 m

Life cycle & reproduction4

Deciduousnessevergreen

Dispersal typewind

Life formtree

Life spanperennial

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)11.28 mm²/mg

Wood density534 mg/cm³

03Chemical composition1 compounds

Compounds documented for Gluta wallichii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Silicon oxide		present	LOTUS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gluta wallichii has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences10

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLLC736600.1 ↗432 bpMalaysia

ACGT

ACAGAGACTAAAGCAAGTGTTGGATTCAAAGCCGGCGTTAAAGACTATAAATTGACTTATTATACTCCTGACTATATAACCAAAGATACT …

Gluta wallichii 311099 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxgenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL4★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type323 records

Wild obs. + sensor12

Museum / vouchered311

Range

Area of Occupancy AOO600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 4

7 georeferenced · 5 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 310 without coordinates

Open the institutions mapphysical evidence311

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	8
Bronx, US	4
Honolulu, US	3
Cibinong Science Center, Herbarium Bogorienselocation not on record	3
Ann Arbor, US	1
Xiamen, CN	1
Cambridge, US	1
University of Stellenboschlocation not on record	1
Fort Worth, US	1

9 institutions · 23 of 311 vouchered records shown · 288 without an institution code

09Environmental DNA4 detections

Where the DNA of Gluta wallichii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 26.1–26.5

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C 29.1–29.5

Min temp (night)22.6 °C 22.6–24.2

Precipitation269 mm/mo 269–346

Air humidity68.1 % 68.1–69.5

Moisture balance133 mm/mo 133–210

Vapour deficit1,080 Pa 1,050–1,080

Wind speed1.20 m/s 0.9–1.20

Cloud cover57.6 % 48.2–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)