Gluta usitata

(Wall.) Ding Hou · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Anacardiaceae/Gluta

At a glance

Occurrence records89

Data sources8

Biological traits14

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Gluta usitata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility89 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS · NPASS39 compounds

Occurrence & distributionGBIF89 records

DNA & barcodingNCBIsequences

01Narrative

Gluta usitata, previously known as Melanorrhoea usitata is an Asian tree species in the family Anacardiaceae. It may be known as Burmese lacquer,Melanorrhoea usitata at ZipcodeZoo.com theetsee,Melanorrhoea usitata in BoDD – Botanical Dermatology Database thitsi or ringas. It has been identified as an endangered species in Viet Nam, where it may be called sơn đào.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass2 592 mg

Seed mass max3 480 mg

Seed mass min1 850 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Dispersal typewind

Life formtree

Life spanperennial

Habitat & environment4

Climatewet tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density740 mg/cm³

03Chemical composition39 compounds

Compounds documented for Gluta usitata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Catechols with side chains22

Drimane sesquiterpenoids7

Miscellaneous polyketides2

Spongiane diterpenoids1

Documented compounds39 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,4aS,5R,8aR)-5,6-bis(hydroxymethyl)-1,1,4a-trimethyl-1,2,3,4,4a,5,8,8a-octahydronaphthalen-2-ol	present	NPASS
(3aS,5aR,7S,9aS,9bS)-7-hydroxy-6,6,9a-trimethyl-3a,4,5,5a,7,8,9,9b-octahydro-1H-benzo[e][2]benzofuran-3-one	present	NPASS
1,2-Dimethoxy-3-(10-phenyldecyl)benzene	present	LOTUS
1,2-Dimethoxy-3-(12-phenyldodecyl)benzene	present	LOTUS
1,2-Dimethyl-3-pentadecylcyclohexa-3,5-diene-1,2-diol	present	LOTUS
1,2-Dimethyl-4-(12-phenyldodecyl)cyclohexa-3,5-diene-1,2-diol	present	LOTUS
1,2-Dimethyl-4-pentadecylcyclohexa-3,5-diene-1,2-diol	present	LOTUS
1,2-Dimethyl-5-(12-phenyldodecyl)cyclohexa-3,5-diene-1,3-diol	present	LOTUS
1-(3-Hydroxyphenyl)-10-phenyldodecan-2-one	present	LOTUS
1-(3-Hydroxyphenyl)-12-phenyldodecan-2-one	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gluta usitata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLMT364375.1 ↗366 bp

ACGT

GTAGCTCCTCAACCTGGAGTTCCACCCGAGGAAGCAGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACC …

Gluta usitata isolate Quyen Q4 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

08Occurrence & distribution

Record type89 records

Wild obs. + sensor33

Museum / vouchered56

Range

Area of Occupancy AOO268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 4≤10 km 1>10 km 1

8 georeferenced · 25 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 2≤1 km 2≤10 km 2

6 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	6
Xiamen, CN	2
Philadelphia, US	2
Kagoshima, JP	1
South Kensington, GB	1

5 institutions · 12 of 56 vouchered records shown · 44 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)